Anti m6a antibody

meRIP was performed as previously described^{4 (link)}. Briefly total RNA was extracted
using Trizol reagent (Invitrogen). RNA was treated with RNAse-free DNAse I
(Roche) to deplete DNA contamination. PolyA RNA was purified using a
GenElute mRNA Miniprep Kit (Sigma-Aldrich) as per the manufacturer’s
instructions and fragmented using a RNA fragmentation kit (Ambion). Two
hundred micrograms of fragmented RNA was incubated with 3 μg anti-m6A
antibody (Synaptic Systems, catalogue number 202 003; RIP validation and
peer-reviewed citations at https://www.bioz.com/result/affmity purified anti m6
a polyclonal antibody/product/Synaptic
Systems/?r=4.95&cf=0&uq=Synaptic Systems
methyladenosine) in RIP buffer (150mM NaCl, 10mM Tris and
0.1% NP40) for 2 h at 4 °C, followed by the addition of washed
protein A/G magnetic beads (Millipore) and incubation at 4 °C for a
further 2 h. Beads were washed 6 times in RIP buffer and incubated with 50
μl immunoprecipitation buffer containing 0:5 mg
ml⁻¹ m⁶AMP (Sigma-Aldrich) to elute RNA.
Immunoprecipitated RNA was extracted with phenol/chloroform and RNA samples
were sent for high-throughput sequencing.

Total RNA was isolated from METTL3-KD or scrambled control U87MG GBM cells, as mentioned above, and the mRNA was further separated using Dynabeads mRNA Purification Kit (Invitrogen, 61006). After fragmentation, using RNA fragmentation reagent (Invitrogen, AM8740), the obtained mRNA was immunoprecipitated with anti-m⁶A antibody (Synaptic Systems, 202003), and then washed and eluted by competition with m⁶A sodium salt (Sigma-Aldrich, M2780). Both input samples and immunoprecipitation (IP) eluates were used for preparing the sequencing libraries using NEBNext Ultra RNA Library Prep Kit for Illumina and submitted for sequencing using Illumina HiSeq 2500. Reads, mapping and m⁶A peak calling, were performed as previously described(25 (link)). The m⁶A peaks of shMETTL3 U87MG cells were from the overlapped peaks of shMETTL3-1 and shMETTL3-2.

poly(A)+RNA was isolated from whole bone marrow cells or sorted HSCs using Dynabeads Oligo-(dT)25 magnetic beads (ThermoFisher Scientific) according to manufacturer’s instructions. 1.25 μg of anti-m⁶A antibody (Synaptic Systems) was pre-bound to Protein A/G magnetic beads (Millipore) in IP buffer (20-mM Tris pH 7.5, 140-mM NaCl, 1% NP-40, 2-mM EDTA) for 1 h. Sample RNA was incubated with antibody-bound Protein A/G beads for 2 hours at 4 °C. Samples were washed twice in low-salt-wash buffer (10-mM Tris pH 7.5, 5 mM EDTA), twice with high-salt-wash buffer (20-mM Tris pH 7.5, 1-M NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1-mM EDTA) and twice with RIPA buffer (20-mM Tris pH 7.5, 150-mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1-mM EDTA). All wash solutions for each sample were collected as the “unbound” fraction. RNA was eluted from the beads by incubating with 50μl 20mM N6-methyladenosine 5-monophosphate sodium salt (Sigma-Aldrich) for 1hr at 4 °C. Following ethanol precipitation, input, unbound, and m⁶A-bound fraction RNA was reverse-transcribed using Superscript III (Invitrogen) with random hexamers. Enrichment of m⁶A-containing transcripts was determined by quantitative PCR relative to Rplp0 expression. The primer sequences for Rplp0: GATGGGCAACTGTACCTGACTG and CTGGGCTCCTCTTGGAATG.