Quikchange 2 xl site directed mutagenesis kit

Manufactured by Agilent Technologies

Sourced in United States, Germany, Canada, United Kingdom, France

The QuikChange II XL Site-Directed Mutagenesis Kit is a lab equipment product designed for introducing site-specific mutations in double-stranded plasmid DNA. It utilizes a proprietary DNA polymerase enzyme and specialized reaction components to efficiently generate desired mutations.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

QuikChange II Site-Directed Mutagenesis Kit (865 citations) QuikChange (236 citations) QuikChange mutagenesis kit (187 citations) QuikChange kit (139 citations) QuikChange site-directed mutagenesis (131 citations) QuikChange mutagenesis (94 citations) QuikChange II (86 citations) QuikChange II XL (85 citations) Site-directed mutagenesis (55 citations) QuikChange XL kit (29 citations)

647 protocols using quikchange 2 xl site directed mutagenesis kit

Gateway Cloning and Site-Directed Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

TNK2 transcript variant 1 in pDONR was purchased from GeneCopoeia (GC-Y4392). Gene mutations were made using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies), and primers were designed using the Agilent Technologies primer design tool. WT and mutated TNK2 were transferred into a Gateway-converted version of pMXs-IRES-Puro (Cell Biolabs Inc.) or MSCV-IRES-GFP using a Gateway LR Clonase kit (Invitrogen). Plasmid sequencing was confirmed via Sanger Sequencing (Eurofins Genomics).
PTPN11 transcript variant 1 in pDONR was purchased from GeneCopoeia (A0360). Gene mutations were made using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies), and primers were designed using the Agilent Technologies primer design tool. WT and mutated PTPN11 were transferred into a Gateway-converted version of p3X-CMV-FLAG14, MSCV-IRES-GFP, or pLenti CMV/TO GFP-Zeo DEST (719-1) (Addgene #17431), or pcDNA 3.2 (Invitrogen) using a Gateway LR Clonase kit (Invitrogen). Plasmid sequencing was confirmed via Sanger Sequencing (Eurofins).

Jenkins C., Luty S.B., Maxson J.E., Eide C.A., Abel M.L., Togiai C., Nemecek E.R., Bottomly D., McWeeney S.K., Wilmot B., Loriaux M., Chang B.H, & Tyner J.W. (2018). Synthetic lethality of TNK2 inhibition in PTPN11-mutant leukemia. Science signaling, 11(539), eaao5617.

+ Open protocol

+ Expand

Engineered 4CL and STS Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

pETD-T7-4CL(N)-T7-STS was constructed via QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) with primers Pf_4CL(N) and Pr_4CL(N) (N = −10.3, −9.4, −8.1, −7.6, −7.0, −5.0, −4.1 kcal/mol, values mean the free energy of every 4CL secondary structure) and the template pETD-T7-4CL(N)-T7-STS. pETD-T7-4CL(−5.0)-T7-STS(M) was constructed via QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) and primers Pf_STS(M) and Pr_STS(M) (M = −8.0, −6.3, −5.1, −4.9, −4.4 kcal/mol, values mean the free energy of every STS secondary structure).

Wu J., Zhang X., Zhu Y., Tan Q., He J, & Dong M. (2017). Rational modular design of metabolic network for efficient production of plant polyphenol pinosylvin. Scientific Reports, 7, 1459.

+ Open protocol

+ Expand

Transcriptional Regulation Assays

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

OSMI-1 (Sigma, 50 μM), 6-Ac-CAS (GlycoSyn, 10 μM), PUGNAc (Toronto Research Chemicals, 10 μM) were used when indicated. The Myc-hOGT plasmid was provided by Dr. Xiaochun Yu at the University of Michigan (Chen et al., 2013 (link)). Ngn3-luc was generated by inserting a ~4.1 kb promoter of the mouse Ngn3 gene into the pGL3-basic vector. IRE-luc was generated by inserting the −1985 to −280 bp upstream of the mouse Irs2 gene that contains two insulin-response elements (IREs) into the pGL3-basic vector. pCMV6-mNgn3-Myc-DDK (#MR212139) was purchased from Origene. pCMV-FOXO1 (#12148) was purchased from Addgene. pCMV-FOXO-4A was generated with the QuikChange XL II Site-Directed Mutagenesis Kit (Agilent). HepG2 and Caco-2 cells were transfected with expression plasmids, luciferase reporters, and β-galactosidase or Renilla-luciferase using Lipofectamine 3000 (Invitrogen) or FuGENE HD (Promega). Cells were lysed and luciferase and β-galactosidase enzyme activities were measured using kits from Promega. Relative luciferase activity was determined by normalizing to β-galactosidase or Renilla-luc activity (Ruan et al., 2012 (link); Wang et al., 2018 (link)).

Zhao M., Ren K., Xiong X., Cheng M., Zhang Z., Huang Z., Han X., Yang X., Alejandro E.U, & Ruan H.B. (2020). Protein O-GlcNAc Modification Links Dietary and Gut Microbial Cues to the Differentiation of Enteroendocrine L Cells. Cell reports, 32(6), 108013.

+ Open protocol

+ Expand

CRISPR Plasmid Construction and Protein Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang (AddGene plasmid # 42230) (Cong et al., 2013 (link)). Guide sequences were designed using an online program (http://crispr.mit.edu/) and cloned into the pX330 vector as described by the Zhang lab (http://www.addgene.org/crispr/zhang/). The following guide RNA was used: Ddx3x exon 1 5’-AGTGGAAAATGCGCTCGGGC-3’. The TCF/LEF-H2B:GFP plasmid was a gift from Anna-Katerina Hadjantonakis (AddGene plasmid # 32610 (Ferrer-Vaquer et al., 2010 (link))). Dcp1a-RFP was a gift from Stacy Horner’s lab. pCAG-DDX3X was generated by amplifying full length human DDX3X from cDNA and subcloning into the pCAG-EX2 vector using NEBuilder HiFi DNA Assembly Kit. GFP or FLAG tags were added upstream of the DDX3X to generate fusion proteins. The NEBuilder kit was also used to engineer point mutations. The Dcx::mCherry plasmids were a kind gift of Santos Franco.
All biochemical experiments were performed using DDX3X from amino acid residues 132–607 (NP-001347.3) in a pHMGWA vector backbone containing a 5’ 6xHis-MBP tag, as described, (Floor et al., 2016b (link)). Mutant clones were generated using Quikchange XL-II site directed mutagenesis kit (Agilent Cat Number: 200521) with the following primers:

Lennox A.L., Hoye M.L., Jiang R., Johnson-Kerner B.L., Suit L.A., Venkataramanan S., Sheehan C.J., Alsina F.C., Fregeau B., Aldinger K.A., Moey C., Lobach I., Afenjar A., Babovic-Vuksanovic D., Bézieau S., Blackburn P.R., Bunt J., Burglen L., Campeau P.M., Charles P., Chung B.H., Cogné B., Curry C., D’Agostino M.D., Di Donato N., Faivre L., Héron D., Innes A.M., Isidor B., Keren B., Kimball A., Klee E.W., Kuentz P., Küry S., Martin-Coignard D., Mirzaa G., Mignot C., Miyake N., Matsumoto N., Fujita A., Nava C., Nizon M., Rodriguez D., Blok L.S., Thauvin-Robinet C., Thevenon J., Vincent M., Ziegler A., Dobyns W., Richards L.J., Barkovich A.J., Floor S.N., Silver D.L, & Sherr E.H. (2020). Pathogenic DDX3X mutations impair RNA metabolism and neurogenesis during fetal cortical development. Neuron, 106(3), 404-420.e8.

+ Open protocol

+ Expand

Lentiviral Transduction of PI5P4Ks

Check if the same lab product or an alternative is used in the 5 most similar protocols

Replication-deficient lentiviruses were prepared using a third-generation lentiviral system. GFP was inserted by itself or upstream of either human PIP4K2A or PIP4K2B in a lentiviral vector. Cysteine to Serine point mutations were made using the Quikchange XL II site-directed mutagenesis kit (Agilent). Virus was generated by cotransfecting three helper plasmids (pLP1, pLP2, pVSV-G) and the vector containing the gene of interest with c/s-acting sequences for proper packaging were used to generate pseudovirions. A subconfluent culture of HEK293T cells was transfected using the CalPhos Mammalian Transfection Kit (Clontech). The titer of each virus was determined using HEK293T cells. Viral supernatant was then used to express PI5P4Ks in HeLa cells.

Sivakumaren S.C., Shim H., Zhang T., Ferguson F.M., Lundquist M.R., Browne C.M., Seo H.S., Paddock M.N., Manz T.D., Jiang B., Hao M.F., Krishnan P., Wang D.G., Yang T.J., Kwiatkowski N.P., Ficarro S.B., Cunningham J.M., Marto J.A., Dhe-Paganon S., Cantley L.C, & Gray N.S. (2020). Targeting the PI5P4K lipid kinase family in cancer using covalent inhibitors. Cell chemical biology, 27(5), 525-537.e6.

+ Open protocol

+ Expand

Generating Mutant Sodium Channel Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols

A plasmid pcDNA3.1(+)-Na_V1.2, encoding the human Na_V1.2 protein, is the WT plasmid used in this study and has been previously described [13 ]. The variant creating the amino acid substitution in position 752 of the Na_V1.2 protein was introduced into pcDNA3.1(+)-hNa_V1.2 as a service by TOP Gene Technologies. Successful mutagenesis was confirmed by DNA sequencing.
A plasmid pcDNA3-Na_V1.6 encoding the mouse Na_V1.6 protein has been previously described [14 (link)]. The plasmid contains the Y371S substitution which converts the tetrodotoxin sensitivity of Na_V1.6 from nanomolar to micromolar concentrations upon expression in mammalian cell lines [14 (link)]. This is the WT plasmid in this study. The mutation creating the amino acid substitution in position 929 of the Na_V1.6 protein was introduced into pcDNA3-mNa_V1.6 using the QuikChange XL II site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) and the following primers (mutated codons italicised): CCACTCCTTCCTCATCTTCTTCCGAGTGC (forward) and GCACTCGGAAGAAGATGAGGAAGGAGTGG (reverse). Successful mutagenesis was confirmed by DNA sequencing.

Oliva M.K., McGarr T.C., Beyer B.J., Gazina E., Kaplan D.I., Cordeiro L., Thomas E., Dib-Hajj S.D., Waxman S.G., Frankel W.N, & Petrou S. (2014). Physiological and genetic analysis of multiple sodium channel variants in a model of genetic absence epilepsy. Neurobiology of disease, 67, 180-190.

+ Open protocol

+ Expand

Transcriptional Regulation Assays

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Cloning and Validating 3'UTR Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 3'UTR regions of human CLSTN1 (NM_001009566.2, 1-1,426), DLGAP4 (XM_005260333.3, 1-1,602), GRASP ( X M _ 0 1 1 5 3 7 9 9 6 . 1 , 1 - 6 3 6 ) , GRIN1 ( N M _ 0 0 7 3 2 7 . 3 , 1-1,235), GRM4 (XM_011514531.1, 1-947), and STX1A (XM_011516541.1, 1-1,157) were PCR amplified from fetal or adult brain cDNA libraries and subcloned into the psiCHECK-2 vector (Promega). Mutagenesis reactions of the GRM4 3'UTR construct were performed using the QuikChange XL II Site-Directed Mutagenesis Kit (Agilent Technologies) to change the three nucleotides of the miR-1908-5p seed match regions (position 4 to 6, CGC) into complementary sequences (GCG). HEK293T cells in 24-well plates were transfected with 30 ng of psiCHECK-2 construct plus 20 pmol of either cel-miR-67 (negative control miRNA) or miR-1908-5p duplex (miRIDIAN Dharmacon) using Lipofectamine 2000 (Invitrogen). After 24 h, luciferase activities were measured using the Dual Luciferase Reporter Assay System (Promega).

Kim Y., Zhang Y., Pang K., Kang H., Park H., Lee Y., Lee B., Lee H.J., Kim W.K., Geum D, & Han K. (2016). Bipolar Disorder Associated microRNA, miR-1908-5p, Regulates the Expression of Genes Functioning in Neuronal Glutamatergic Synapses. Experimental Neurobiology, 25(6), 296-306.

+ Open protocol

+ Expand

NHLRC1 Knockdown and Overexpression in Lung Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Knock-down of NHLRC1 in A549 and H1299 cells was done with siRNA pools or negative control pools (siTools, Planegg, Germany) with RNAiMAX (Thermo Scientific) transfection reagent diluted in OptiMEM (Thermo Scientific) according to the manufacturers’ instructions.
NHLRC1 coding region (Supplementary Table S2) was cloned into the pCRII-cGFP backbone expressing a GFP independently of the insert as transfection control. NHLRC1 C26S catalytic mutant was generated with Quikchange XL II site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA) according to the manufacturer’s instructions (Supplementary Table S2). Correct sequences were checked by Sanger sequencing (Eurofins MWG Operon, Ebersberg, Germany). We transiently transfected H1299 cells using Lipofectamine3000 transfection reagent (Thermo Scientific) according to the manufacturer’s instructions for 36 h. Cells were treated with 50 µM LY294002 PI3K inhibitor (Cell Signalling Technology, Danvers, Massachusetts, U.S.; CST) or DMSO (Thermo Scientific) control for 1 h prior to protein isolation.

Faltus C., Lahnsteiner A., Barrdahl M., Assenov Y., Hüsing A., Bogatyrova O., Laplana M., Johnson T., Muley T., Meister M., Warth A., Thomas M., Plass C., Kaaks R, & Risch A. (2022). Identification of NHLRC1 as a Novel AKT Activator from a Lung Cancer Epigenome-Wide Association Study (EWAS). International Journal of Molecular Sciences, 23(18), 10699.

+ Open protocol

+ Expand

FOXP3 Regulation via OGT/OGA

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK 293 T cells (ATCC) were cultured in DMEM with 10% fetal bovine serum (FBS). TMG (CarboSynth, 10 μM), ST045849 (TimTec, 100 μM), MG132 (Cayman, 20 μM), and cycloheximide (Sigma, 100 μg/ml) were treated as indicated. The mouse FOXP3-Myc/DDK plasmid was purchased from OriGene (MR227205). Point mutants of FOXP3 were generated with the QuikChange XL II Site-Directed Mutagenesis Kit (Agilent). pCMV-Myc-human OGT and 3xFlag/2xMyc-OGA were kindly provided by Dr. Xiaochun Yu at University of Michigan and Dr. Xiaoyong Yang at Yale University, respectively. FOXP3-Myc/DDK was subcloned into the 3xFlag/2xMyc empty vector to construct the 3xFlag/2xMyc-FOXP3-Myc/DDK plasmid. IL-2 promoter luciferase (#12194) and pIS1 (#12179) were from Addgene. Cells were transfected with FuGENE HD (Promega) according to manufacturer’s instructions.

Liu B., Salgado O.C., Singh S., Hippen K.L., Maynard J.C., Burlingame A.L., Ball L.E., Blazar B.R., Farrar M.A., Hogquist K.A, & Ruan H.B. (2019). The lineage stability and suppressive program of regulatory T cells require protein O-GlcNAcylation. Nature Communications, 10, 354.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!