To compare the mRNA levels of genes in the mutagenesis group and in the control group, we used the SYBR green core reaction to perform quantitative PCR (Applied Biosystems model 7300 Real-Time PCR System, Carlsbad, CA). Real-time PCR analyses were carried out on a final volume of 25 µl containing 40 ng of the cDNA sample, 50 nM of each gene-specific primer, and 12.5 µl of the SYBER green taq premixture. The PCR conditions included enzyme activation at 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s, and annealing/extension at 60 °C for 1 min. To verify that a single product had been amplified, a dissociation curve was generated at the end of each PCR cycle using the software provided by the Applied Biosystems 7300 Real-Time PCR System (version 1.4). The relative expression of each gene was normalized to that of the ACT1 gene (ΔCt) and quantified with the ΔΔCt relative quantification method. The relative expression ratio was calculated according to ABI’s guideline, that is, ratio (Swapped/BY4741) = 2(−ΔΔCt). The amplification efficiency of each primer pair was tested by using 2-fold serial dilutions of the templates as suggested by ABI; and the amplification efficiencies of the target gene and the reference gene were approximately equal. Finally, the mRNA levels of the candidate genes were compared, using a paired t-test.
7300 real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Singapore, Spain, France, Canada, Italy, Switzerland, Belgium
The 7300 Real-Time PCR System is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It provides precise detection and quantification of target DNA sequences in samples. The system includes a thermal cycler, optical detection module, and analysis software to enable real-time monitoring of PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (317 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (182 mentions)
Rneasy mini kit, by Qiagen (174 mentions)
Trizol, by Thermo Fisher Scientific (126 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (119 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (90 mentions)
Primescript rt reagent kit, by Takara Bio (76 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (66 mentions)
Rneasy kit, by Qiagen (59 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (46 mentions)
Quantitect reverse transcription kit, by Qiagen (45 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (43 mentions)
Nanodrop, by Thermo Fisher Scientific (43 mentions)
Sybr premix ex taq, by Takara Bio (39 mentions)
Sybr green 1 master mix kit, by Thermo Fisher Scientific (38 mentions)
Taqman probe, by Thermo Fisher Scientific (34 mentions)
Iscript cdna synthesis kit, by Bio-Rad (33 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (33 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (29 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (29 mentions)
1 919 protocols using 7300 real time pcr system
1
Quantitative RT-PCR Analysis of Gene Expression
2
Quantifying DR5 and miR-221 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the cells was extracted using a mirVana miRNA Isolation kit (Applied Biosystems, Foster, CA, USA), according to the manufacturer’s instructions. For quantitative real-time RT-PCR, total RNA (2 μg) was reverse-transcribed to cDNA in a 20 μL reaction volume using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems) according to the manufacturer’s instructions. TaqMan probes for DR5 and β2-microglobulin (β2MG) were purchased from Applied Biosystems. The expression levels of mRNAs were quantified using the Applied Biosystems 7300 Real-Time PCR system according to the manufacturer’s instructions. The expression level of DR5 mRNA was normalized against the level of β2MG mRNA in the same sample.
microRNA expression analysis was performed by using TaqMan miRNA assays (Applied Biosystems) to evaluate miR-221. Total RNA (10 ng) was reverse-transcribed to cDNA in a 15 μL reaction volume using each specific primers and TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems). The expression levels of microRNAs were quantified using the 7300 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions. The results were normalized relative to the RNA gene RNU48.
microRNA expression analysis was performed by using TaqMan miRNA assays (Applied Biosystems) to evaluate miR-221. Total RNA (10 ng) was reverse-transcribed to cDNA in a 15 μL reaction volume using each specific primers and TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems). The expression levels of microRNAs were quantified using the 7300 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions. The results were normalized relative to the RNA gene RNU48.
3
Quantitative Gene Expression Analysis in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated from mouse hepatocytes, 3T3-L1 cells, adipose tissue and liver using TRIzol reagent as per the manufacturer's instructions. Reverse transcription was performed with a high-capacity complementary DNA reverse transcription kit (Applied Biosystems, Foster City, CA). Quantitative reverse transcriptase-PCR was then performed on a 7300 Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as per the manufacturer's instructions. Beta actin was used as the endogenous control. The PCR amplifications were examined using the 7300 Real-Time PCR system operated SDS version 1.4 program and Delta Rn analysis method (Applied Biosystems). The primers used for quantitative reverse transcriptase-PCR are shown in Table 1 .
4
Quantitative PCR Analysis of Retinal Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolations from the RB cell lines were performed using the NucleoSpin RNA II kit (Machery and Nagel), and cDNA was synthesized with the QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s protocols. Pooled human adult total retinal RNA, used as a reference, was purchased from Clontech (cat.# 636579). Quantitative Real-time PCR analyses were performed using a 7300 Real-Time PCR System (Applied Biosystems). The following Taqman Gene Expression Assays (Applied Biosystems) were used: RARα: Hs00940446_m1; RARß: Hs00977140_m1; RARγ: Hs00199455_m1; RXRγ: Hs00199455_m1; and Apaf-1: Hs00559421_m1. GAPDH (ID Hs99999905_m1) as an endogenous control. Real-time PCR reactions were performed in duplicate with a total volume of 20 μl applied to the following program: 2 min 50°C, 10 min 95°C, followed by 40 cycles of 15 sec 95°C and 60 sec 60°C. Relative quantification was calculated by the 7300 Real-Time PCR System software (Applied Biosystems). Results represent mean values of at least four independent experiments.
5
Analyzing ISR-associated miRNAs in Maize
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After being inoculated with FZB42, FZB42△sfp△alss mutant or the control for 6, 12 and 24 h, the maize leaves were harvested and used for RNA isolation. qRT-PCR analysis was performed with a 7300 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The GAPDH and Actin genes were used as internal references.
The expression levels of candidate ISR-associated miRNAs were verified with stem-loop qRT-PCR. Total RNA was reverse transcribed to first-strand cDNA with a stem-loop reverse transcription primer, and then performed with a 7300 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The 18s rRNA was used as internal references. The primer sequences of these genes are listed inTable S9 . The expression levels of marker genes and miRNAs were calculated according to the 2−△△ct relative quantification method. Each sample contained three biological replicates and was repeated three times.
The expression levels of candidate ISR-associated miRNAs were verified with stem-loop qRT-PCR. Total RNA was reverse transcribed to first-strand cDNA with a stem-loop reverse transcription primer, and then performed with a 7300 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The 18s rRNA was used as internal references. The primer sequences of these genes are listed in
6
Quantifying Gene Expression in Lung Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from H358 cells and a normal lung cell line MRC-5 cells with or without treatment of anti-CYR-61 using an RNeasy mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA), according to the manufacturer's protocol. RNA (1.0 µg) was reverse transcribed into cDNA using QuantiTect Reverse Transcription kit (Qiagen Sciences, Inc.), according to the manufacturer's protocol. The primers (Table I ) were designed using Primer Express software (version 2.0; Thermo Fisher Scientific, Inc.) qPCR analysis was performed using the SYBR®Premix™Ex Taq™ (Perfect Real Time; Takara Biotechnology Co., Ltd., Dalian, China) in a total volume of 20 µl using a 7300 Real-Time PCR System (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The thermocycling conditions were as follows: 95°C for 30 sec, and 40 cycles of 95°C for 5 sec and 60°C for 30 sec. All relative mRNA expression levels were calculated using the by 2−ΔΔCq method (25 (link)). Results were expressed as the n-fold relative to the housekeeping gene, β-actin.
7
Quercetin Modulates miRNA and Cytokine Expression in Bovine Neutrophils
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed to investigate the effect of quercetin on miRNAs and proinflammatory cytokine gene expression in bovine neutrophils. Analysis of the levels of gene expression was performed in triplicate on an Applied Biosystems 7300 real-time PCR system equipped with SDS software v1.4 (Thermo Fisher Scientific). The real-time PCR was performed using a SensiFAST SYBR® Hi-ROX Kit (Bioline) as per the manufacturer’s instructions. The cycling conditions were set as follows: An initial denaturation of 95°C for 2 min, followed by 40 (mRNAs) or 45 cycles (miRNAs) of denaturation at 95°C for 5 s, and annealing/extension at 60°C for 30 s. Subsequently, specificity was confirmed by dissociation curve analysis (Tm). Correct product sizes were also determined by 2% agarose gel in 0.5 X tris-acetate-ethylenediaminetetraacetic acid (TAE) buffer at 100 V for 35 min. The gels were stained with ethidium bromide (0.5 µg/mL) and documented using the GelMax Imager (Ultra-Violet Products, Cambridge, UK). Analysis of relative gene expression was calculated from the CT of miRNA genes/proinflammatory genes and MIR16A/β-actin (ACTB). The expression levels (fold difference) were reported using the 2–ΔΔCT method [23 (link)].
8
Quantification of miR-103a-3p in Leukocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from 100 μl leukocytes using the NucleoSpin miRNA kit (Macherey-Nagel GmbH & Co KG, Düren, Germany) according to manufacturer’s instructions. Subsequently, miR-103a-3p was determined as described elsewhere with miR-125a as reference using quantitative Real-Time PCR (qRT-PCR) [19 (link)]. Most of the samples (N = 275) were analyzed in 2015 using the 7300 Real-Time PCR System (Thermo Fisher Scientific, Darmstadt, Germany), whereas 51 samples were analyzed in 2021 using the QuantStudio 7 Pro PCR system (Thermo Fisher Scientific, Darmstadt, Germany). Differences between cases and controls were similar in 2015 and 2021 (S1A Fig ). Although group differences between years exist, all miR-103a-3p levels measured in 2021 were within the range of the measurements from 2015 (S1B Fig ). Indeed, Matias-Garcia et al. reported that miR-103a-3p is not altered by long-term frozen storage or freeze-thaw cycles [28 (link)]. Thus, all miR-103a-3p values were integrated in subsequent analyses.
9
RT-qPCR Analysis of CD74 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from BV2 cells using TRIzol reagent (Invitrogen). The mRNA was reverse transcribed using the ReverTra qPCR RT Kit (Toyobo, Osaka, Japan). The CD74 mRNA level was measured with the SYBR Premix Ex TaqII kit (Takara, Dalian, China) using a 7300 real-time PCR system (Thermo Fisher Scientific). The CD74 mRNA level was normalized to the expression of
β-actin and calculated using the 2
–ΔΔCt method.
β-actin and calculated using the 2
–ΔΔCt method.
10
Quantitative Analysis of circVMA21 and miR-497-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA was adopting TRIzol LS reagent (Invitrogen), and reverse transcription was into cDNA adopting ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan) on the basis of the manufacturer’s instructions. Separation of the target miRNA was adopting miRVana™ miRNA isolation kit (Invitrogen). Performance of the reverse transcription of miRNA was via adopting All-in-One™ miRNA RT-qPCR detection kit (GeneCopoeia Inc., Rockville, USA). Amplification of the target gene was performed exerting the 7300 real-time PCR system (Thermo Fisher Scientific). Manifestation of miRNA and mRNA was with U6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as standard, separately. Calculation of the gene was adopting 2−ΔΔCt equation. The primer sequences were presented in Table 1 .
PCR primer sequence
| Primer sequence (5′ – 3′) | |
|---|---|
| CircVMA21 | F: 5’- GCTGGCCCTCTTTGTGTATG-3’ |
| R: 5’- AATCCTGTTTGCCTTCACGC-3’ | |
| MiR-497-5p | F: 5’-CCTTCAGCAGCACACTGTGG-3’ |
| R: 5’- CAGTGCAGGGTCCGAGGTAT-3’ | |
| CD2AP | F: 5’- CTGTCAGCTGCAGAGAAGAAA −3’ |
| R: 5’- TTGGGTTGGAGAATGTCCAC-3’ | |
| GAPDH | F: 5’- CTGCCAACGTGTCAGTGGTG-3’ |
| U6 | F: 5’- CGAATTTGCGTGTCATCCTT-3’ |
| R: 5’- CGAATTTGCGTGTCATCCTT-3’ |
F: Forward; R: Reverse
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!