Log In Sign up
The largest database of trusted experimental protocols

Pl crispr efs gfp

Manufactured by Addgene
Visit Supplier

The PL-CRISPR.EFS.GFP is a plasmid vector that contains the CRISPR-Cas9 system components for gene editing. It includes the EFS promoter-driven expression of the Cas9 endonuclease and a GFP reporter. This vector provides the necessary tools for CRISPR-mediated genome engineering.

Automatically generated - may contain errors

Lab products found in correlation

Polybrene, by Merck Group (3 mentions) Pmd2 g, by Addgene (3 mentions) T7 endonuclease, by New England Biolabs (2 mentions) Fetal calf serum (fcs), by Merck Group (2 mentions) Pcr4blunt topo vector, by Thermo Fisher Scientific (2 mentions) Slhp033rs, by Merck Group (2 mentions) Plvxtre3gzsgreen1 vector, by Takara Bio (2 mentions) Pet28alic, by Addgene (2 mentions) Grna oligonucleotides, by Merck Group (2 mentions) Plko5 sgrna efs trfp, by Addgene (2 mentions) Pbabe puro, by Addgene (1 mentions) Pspcas9 bb 2a gfp, by Addgene (1 mentions) Pljm1 egfp, by Addgene (1 mentions) Plvthm, by Addgene (1 mentions) Gibson assembly master mix, by New England Biolabs (1 mentions) Geneart genomic cleavage detection kit, by Thermo Fisher Scientific (1 mentions) Quikchange 2 xl site directed mutagenesis kit, by Agilent Technologies (1 mentions) Plvx tre3g zsgreen1, by Takara Bio (1 mentions) In fusion hd cloning kit, by Takara Bio (1 mentions) Aria 3 instrument, by BD (1 mentions)

Spelling variants of this product

PL-CRISPR.EFS.GFP vector (5 citations) PL-CRISPR (3 citations) PL-CRISPR.EFS.GFP lentiviral vector (2 citations)

11 protocols using pl crispr efs gfp

1

CRISPR-based EXT1 and CXCL12 Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
pLenti-CRISPR-sgEXT1 was constructed by inserting sgRNA-EXT1 (GACCCAAGCCTGCGACCACG) into pL-CRISPR.EFS.GFP (Addgene plasmid # 57818) as previously described [30 (link)]. pLenti-CRISPR-sgCXCL12γ was constructed by inserting sgRNA-CXCL12γ#1 (TTTAACACTGGCCCGTGTAC) and sgRNA-CXCL12γ#2 (AACTGTGGTCCATCTCGAGG) into pL-CRISPR.EFS.GFP [31 (link)]. pBABE-CXCL12α and pBABE-CXCL12γ were constructed by inserting CXCL12α or CXCL12γ cDNA containing C-terminally C9-tagged (TETSQVAPA) sequences into pBABE-puro (Addgene plasmid # 1764). Lentiviral and retroviral particle production and transduction were performed as described before [30 (link)].
Ren Z., Lantermans H., Kuil A., Kraan W., Arenzana-Seisdedos F., Kersten M.J., Spaargaren M, & Pals S.T. (2021). The CXCL12gamma chemokine immobilized by heparan sulfate on stromal niche cells controls adhesion and mediates drug resistance in multiple myeloma. Journal of Hematology & Oncology, 14, 11.
+ Open protocol
+ Expand
2

Lentiviral CRISPR-Mediated NKD2 Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols
The NKD2-specific guide RNA (forward 5′-CACCGACTCCAGTGCGATGTCTCGG -3′; reverse 5′-AAACCCGAGACATCGCACTGGAGTC -3′) were cloned into pL-CRISPR.EFS.GFP (Addgene #57818) using BsmBI restriction digestion. Lentiviral particles were produced by transient co transfection of HEK293T cells with lentiviral transfer plasmid, packaging plasmid psPAX2 (Addgene #12260) and VSVG packaging plasmid pMD2.G (Addgene #12259) using TransIT-LT (Mirus). Viral supernatants were collected 48-72 hours after transfection, clarified by centrifugation, supplemented with 10% FCS and Polybrene (Sigma-Aldrich, final concentration of 8μg/ml) and 0.45μm filtered (Millipore; SLHP033RS). Cell transduction was performed by incubating the PDGFRß cells with viral supernatants for 48hrs. eGFP expressing cells were single cell sorted into 96-well plates. Expanded colonies were assessed for mutations with mismatch detection assay: gDNA spanning the CRISPR target site was PCR amplified and analyzed by T7EI digest (T7 Endonuclease, NEB M0302S). To determine specific mutation events on both alleles within the clones grown, the PCR product was subcloned into the pCR™ 4Blunt-TOPO vector (Thermo Scientific K287520). Minimum 6 colonies per CRISPR-clone were grown and sent for sanger sequencing (Clone C2: 30 colonies have been sequenced).
Kuppe C., Ibrahim M.M., Kranz J., Zhang X., Ziegler S., Perales-Patón J., Jansen J., Reimer K.C., Smith J.R., Dobie R., Wilson-Kanamari J.R., Halder M., Xu Y., Kabgani N., Kaesler N., Klaus M., Gernhold L., Puelles V.G., Huber T.B., Boor P., Menzel S., Hoogenboezem R.M., Bindels E.M., Steffens J., Floege J., Schneider R.K., Saez-Rodriguez J., Henderson N.C, & Kramann R. (2020). Decoding myofibroblast origins in human kidney fibrosis. Nature, 589(7841), 281-286.
+ Open protocol
+ Expand
3

VE-Cad Gene Knockout Using CRISPR

Check if the same lab product or an alternative is used in the 5 most similar protocols
MUM2B knockout (ko) cells for the VE-Cad gene were composed using the CRISPR-Cas9 technology. Five different sgRNAs were designed using the Zhang Lab Optimized CRISPR design tool and cloned into the pL-CRISPR.EFS.GFP which was purchased from the Addgene public repository (#57818) and previously describe [14 (link)].
Delgado-Bellido D., Zamudio-Martínez E., Fernández-Cortés M., Herrera-Campos A.B., Olmedo-Pelayo J., Perez C.J., Expósito J., de Álava E., Amaral A.T., Valle F.O., Diaz A.G, & Oliver F.J. (2023). VE-Cadherin modulates β-catenin/TCF-4 to enhance Vasculogenic Mimicry. Cell Death & Disease, 14(2), 135.
+ Open protocol
+ Expand
4

Genetic Modulation of Human FST

Check if the same lab product or an alternative is used in the 5 most similar protocols
For overexpression, human FST isoforms (FST317 and FST344) were cloned into the pLJM1‐EGFP (Addgene #19319) lentivirus vector. For knockdown, two independent shRNAs were cloned into lentiviral vector pLVTHM (Addgene #12247). Scramble shRNA was used as control. For knockout, five different sgRNAs targeting exon 2 of human FST were designed (http://tools.genome-engineering.org) and cloned into pSpCas9(BB)‐2A‐GFP (Addgene #48138) followed by T7EI assay in 293FT. sgRNA#3 and sgRNA#4 showed highest genome‐editing efficiency and were cloned into pL‐CRISPR.EFS.GFP (Addgene #57818).
He B., Yang N., Man C.H., Ng N.K., Cher C., Leung H., Kan L.L., Cheng B.Y., Lam S.S., Wang M.L., Zhang C., Kwok H., Cheng G., Sharma R., Ma A.C., So C.E., Kwong Y, & Leung A.Y. (2020). Follistatin is a novel therapeutic target and biomarker in FLT3/ITD acute myeloid leukemia. EMBO Molecular Medicine, 12(4), e10895.
+ Open protocol
+ Expand
5

Cloning and Viral Transduction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
We obtained the pET28aLIC (Plasmid #26094) and pL-CRISPR.efs.gfp (plasmid # 57818) plasmids from Addgene and the pLVXTRE3GZsGreen1 vector from Clontech. We amplified the coding sequence of the NT5C2 cDNA from pLOC-NT5C2 (Tzoneva et al., 2013 ) and cloned it into the pET28aLIC vector using In-fusion cloning using the In-Fusion HD Cloning Kit (Clonetch) following manufacturer guidelines. We cloned the NT5C2 S408-D415 loop deletion mutation into the pET28aLIC and pLVXTRE3GZsGreen1 vector using Gibson Assembly using the Gibson Assembly Master Mix (New England Biolabs) following manufacturer guidelines. We cloned a truncated active form of NOTCH1 ΔE-NOTCH1 (Schroeter et al., 1998 (link)) into the pMSCV-pBabeMCS-IRES-RFP retroviral vector (Addgene plasmid # 33337). We generated lentiviral vectors expressing CAS9 and gRNAs targeting the arm segment of mouse Nt5c2 by cloning the corresponding gRNA oligonucleotides (Sigma-Aldrich) into pL-CRISPR.efs.gfp as reported (Shalem et al., 2014 (link)).
Dieck C.L., Tzoneva G., Forouhar F., Carpenter Z., Ambesi-Impiombato A., Sánchez-Martín M., Kirschner-Schwabe R., Lew S., Seetharaman J., Tong L, & Ferrando A.A. (2018). Structure and mechanisms of NT5C2 mutations driving thiopurine resistance in relapsed lymphoblastic leukemia. Cancer cell, 34(1), 136-147.e6.
+ Open protocol
+ Expand
6

PARP-1 Knockout in HEK 293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The production of HEK 293T cells PARP-1 KO was performed thanks to the use of CRISPR-Cas9 technology. Different sgRNAs were selected using the “Zhang Lab Optimized CRISPR design tool” and then cloned into the pL-CRISPR.EFS.GFP obtained from Addgene (#57818). Cells were transfected using JetPrime reagents, then the GeneArt Genomic Cleavage Detection Kit (Invitrogen) was used to validate the sgRNAs following the manufacturer's instructions. The guides number 2 and 4 were selected for, allelic disruption.

Guide 2: GAGTCGAGTACGCCAAGAGC

Guide 4: GCATCCCCAAGGACTCGCTC

These guides were transfected again, the GFP positive cells were isolated and a clone selection was performed after single-cell separation through flow cytometry. Finally, PARP-1 KO status was confirmed by Sanger sequencing and Western Blot.
Martí J.M., Garcia-Diaz A., Delgado-Bellido D., O'Valle F., González-Flores A., Carlevaris O., Rodríguez-Vargas J.M., Amé J.C., Dantzer F., King G.L., Dziedzic K., Berra E., de Álava E., Amaral A.T., Hammond E.M, & Oliver F.J. (2021). Selective modulation by PARP-1 of HIF-1α-recruitment to chromatin during hypoxia is required for tumor adaptation to hypoxic conditions. Redox Biology, 41, 101885.
+ Open protocol
+ Expand
7

Construction of NT5C2 Mutant Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
We obtained the pET28aLIC (Plasmid #26094) and pL-CRISPR.efs.gfp (Plasmid #57818) plasmids from Addgene and pLVXTRE3GZsGreen1 vector from Clontech. We amplified the coding sequence of the NT5C2 cDNA from pLOC-NT5C2(7 (link)) and cloned it into the pET28aLIC and pLVXTRE3GZsGreen1 vectors using In-fusion cloning using the In-Fusion HD Cloning Kit (Clontech) following manufacturer guidelines. We generated lentiviral vectors expressing CAS9 and gRNAs targeting exon 3 or 8 of Nt5c2 by cloning the corresponding gRNA oligonucleotides (Sigma-Aldrich) into pL-CRISPR.efs.gfp as reported(42 (link)). We cloned NT5C2 R238W, K359Q, R367Q, L375F, D407A, K217R, K217Q, K344R, K344Q, S418A, S418D, S502A, S502D, D229A and D229S mutations into the pLOC-NT5C2(7 (link)) or pET28aLIC-NT5C2 by site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies) according to manufacturer’s guidelines.
Reglero C., Dieck C.L., Zask A., Forouhar F., Laurent A.P., Lin W.H., Albero R., Miller H.I., Ma C., Gastier-Foster J.M., Loh M.L., Tong L., Stockwell B.R., Palomero T, & Ferrando A.A. (2022). Pharmacological inhibition of NT5C2 reverses genetic and non-genetic drivers of 6-MP resistance in acute lymphoblastic leukemia. Cancer discovery, 12(11), 2646-2665.
+ Open protocol
+ Expand
8

CRISPR/Cas9 Targeting of Human UCA1 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
Single-guide RNAs (sgRNA) targeting human UCA1 gene were designed in http://crispr.mit.edu/. Oligonucleotides were cloned into the lentiviral vector pL-CRISPR.EFS.GFP (Addgene) and pLKO5.sgRNA.EFS.tRFP (Addgene), respectively. The most effective pair of sgRNAs was used in the following experiments. After 48 h of lentivirus infection in K562 cells, the GFP and RFP double-positive cells were sorted as single cells using an Aria III instrument (BD Biosciences). Colonies emerging from every single cell were expanded and one UCA1 compound heterozygous mutant cell line was identified using genotyping and Sanger sequencing. The sgRNA sequences are: 5ʹ-CACAGGGUCGATTGAUCAGU-3ʹ and 5ʹ-UCTATACGGACACG CGUGAC-3ʹ.
Liu J., Li Y., Tong J., Gao J., Guo Q., Zhang L., Wang B., Zhao H., Wang H., Jiang E., Kurita R., Nakamura Y., Tanabe O., Engel J.D., Bresnick E.H., Zhou J, & Shi L. (2018). Long non-coding RNA-dependent mechanism to regulate heme biosynthesis and erythrocyte development. Nature Communications, 9, 4386.
+ Open protocol
+ Expand
9

Lentiviral CRISPR-Mediated NKD2 Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols
The NKD2-specific guide RNA (forward 5′-CACCGACTCCAGTGCGATGTCTCGG -3′; reverse 5′-AAACCCGAGACATCGCACTGGAGTC -3′) were cloned into pL-CRISPR.EFS.GFP (Addgene #57818) using BsmBI restriction digestion. Lentiviral particles were produced by transient co transfection of HEK293T cells with lentiviral transfer plasmid, packaging plasmid psPAX2 (Addgene #12260) and VSVG packaging plasmid pMD2.G (Addgene #12259) using TransIT-LT (Mirus). Viral supernatants were collected 48-72 hours after transfection, clarified by centrifugation, supplemented with 10% FCS and Polybrene (Sigma-Aldrich, final concentration of 8μg/ml) and 0.45μm filtered (Millipore; SLHP033RS). Cell transduction was performed by incubating the PDGFRß cells with viral supernatants for 48hrs. eGFP expressing cells were single cell sorted into 96-well plates. Expanded colonies were assessed for mutations with mismatch detection assay: gDNA spanning the CRISPR target site was PCR amplified and analyzed by T7EI digest (T7 Endonuclease, NEB M0302S). To determine specific mutation events on both alleles within the clones grown, the PCR product was subcloned into the pCR™ 4Blunt-TOPO vector (Thermo Scientific K287520). Minimum 6 colonies per CRISPR-clone were grown and sent for sanger sequencing (Clone C2: 30 colonies have been sequenced).
Kuppe C., Ibrahim M.M., Kranz J., Zhang X., Ziegler S., Perales-Patón J., Jansen J., Reimer K.C., Smith J.R., Dobie R., Wilson-Kanamari J.R., Halder M., Xu Y., Kabgani N., Kaesler N., Klaus M., Gernhold L., Puelles V.G., Huber T.B., Boor P., Menzel S., Hoogenboezem R.M., Bindels E.M., Steffens J., Floege J., Schneider R.K., Saez-Rodriguez J., Henderson N.C, & Kramann R. (2020). Decoding myofibroblast origins in human kidney fibrosis. Nature, 589(7841), 281-286.
+ Open protocol
+ Expand
10

CRISPR-Mediated −31CBS Deletion and Inversion

Check if the same lab product or an alternative is used in the 5 most similar protocols
We generated −31CBS deletion and inversion cell lines by CRISPR/Cas9 technology. Single-guide RNA (sgRNA) oligos (Sigma) were designed using the CRISPR Design Tool (crispr.mit.edu) according to the target genome sequence and cloned into a pLKO5.sgRNA.EFS.tRFP (Addgene, # 57823) or pL-CRISPR.EFS.GFP (Addgene, # 57818) lentiviral vector. After lentiviral infection, GFP+/RFP+ cells were sorted by flow cytometry. Single cell clones were then selected, and −31CBS deletion and inversion clones were verified by genotyping PCR and Sanger sequencing. The genotyping primers are listed in the Supplementary Table S1.
Li Y., Liao Z., Luo H., Benyoucef A., Kang Y., Lai Q., Dovat S., Miller B., Chepelev I., Li Y., Zhao K., Brand M, & Huang S. (2020). Alteration of CTCF-associated chromatin neighborhood inhibits TAL1-driven oncogenic transcription program and leukemogenesis. Nucleic Acids Research, 48(6), 3119-3133.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!