Trnzol reagent

Manufactured by Thermo Fisher Scientific

Sourced in United States

TRNzol reagent is a solution used for the isolation and purification of total RNA from various biological samples, including cells, tissues, and fluids. It is a guanidinium-based reagent that effectively disrupts cells and denatures proteins, allowing for the efficient extraction and recovery of high-quality RNA.

Automatically generated - may contain errors

Lab products found in correlation

Primescript rt reagent kit, by Takara Bio (2 mentions) Iscript cdna synthesis kit, by Bio-Rad (2 mentions) Faststart universal sybr green master mix, by Roche (2 mentions) Power sybr green pcr master mix, by Takara Bio (1 mentions) Reverse transcription reagent, by Thermo Fisher Scientific (1 mentions) Quantstudio 6 flex, by Thermo Fisher Scientific (1 mentions) Cfx connect real time system, by Bio-Rad (1 mentions) Sybr green qpcr master mix, by Selleck Chemicals (1 mentions) Rnase r, by Qiagen (1 mentions) Genejet rna purification kit, by Thermo Fisher Scientific (1 mentions) Rnase r, by Illumina (1 mentions) Rneasy minelute cleaning kit, by Qiagen (1 mentions) Cfx96 real time pcr detection system, by Bio-Rad (1 mentions) First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Sybr premix ex taq 2, by Takara Bio (1 mentions)

7 protocols using trnzol reagent

Quantitative RT-PCR Analysis of Vitamin D Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The livers, kidneys, and left-side femora were collected immediately after the mice were sacrificed and were freshly frozen in liquid nitrogen. Total RNA from these tissues was isolated using TRNzol reagent (Invitrogen, Carlabad, CA, USA). The RNA was reverse transcribed using a PrimeScript RT Reagent Kit (Cat. #RR036, TaKaRa Bio Inc., CA, USA), and quantitative real time polymerase chain reaction (qRT-PCR) was performed using Power SYBR Green PCR Master Mix (Cat. #4368702, Thermo Fisher Scientific Inc., Waltham, MA, USA) following the manufacturers’ protocols. Beta-actin was employed as the reference gene and the 2^−ΔCt method was used in the data analysis. The primers used in this assessment are as follows:
β-actin: F: GGCTGTATTCCCCTCCATCG; R: CCAGTTGGTAACAATGCCATGT
Vdpb: F: CCTGCTGGCCTTAGCCTTT; R: TGCTCAAATGTGCTACTGGAAA
Vdr: F: CACCTGGCTGATCTTGTCAGT; R: CTGGTCATCAGAGGTGAGGTC

Yang G.(., Chen H., Cheng K.L., Tang M.F., Wang Y., Hung L.H., Cheng C.Y., Mak K.L, & Lee Y.W. (2024). Potential Interaction between WNT16 and Vitamin D on Bone Qualities in Adolescent Idiopathic Scoliosis Patients and Healthy Controls. Biomedicines, 12(1), 250.

+ Open protocol

+ Expand

Gene Expression Quantification Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRNzol Reagent (Invitrogen) and cDNA was acquired by an iScript^TM cDNA Synthesis Kit (Bio-Rad, Richmond, CA, United States). Relative gene mRNA expression levels were quantified by FastStart Universal SYBR Green Master Mix (Roche Diagnostics). β-Actin was used as an internal control. The expression values of target genes represent the means ± SD of three independent experiments. Values were analyzed using the 2^-ΔΔCt method. The primer sequences were designed by our group and were listed in Supplementary Table 1.

Xia Y.Q., Hua R.J., Juan C., Zhong Z.H., Tao C.S., Fang R., Lin H., Rui G, & Yong C. (2018). SIRT6 Depletion Sensitizes Human Hepatoma Cells to Chemotherapeutics by Downregulating MDR1 Expression. Frontiers in Pharmacology, 9, 194.

+ Open protocol

+ Expand

Gene Expression Analysis by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the TRNzol reagent (Invitrogen Life Technologies, CA, USA) following the manufacturer’s instructions. The purity and the concentration of RNA were measured by a spectrophotometer. Total RNA was reverse transcribed into cDNA using the reverse transcription reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions. qRT-PCR was performed to determine gene expression of target genes using SYBR Green Real-time PCR Kit (Shanghai Solarbio Co., China). The qRT-PCR was performed by initial denaturation at 95 ºC for 10 min, followed by 40 cycles of denaturation at 95 ºC for 7 s, annealing at 60 ºC for 20 s, and annealing at 72°C for 38 s. RT-PCR primers are: RUNX3-F: 5ʹ-TGGCAGGCAATGACGA-3 ‘, RUNX3-R: 5ʹ-TGGTTCGGCAAGGGAC-3ʹ; DMNT3b-F: 5ʹ-TCTGGAAAACCTTCCTGCTG-3 ‘, DMNT3b-R: 5ʹ-CCGGCACATAGGTAAA AGGA-3 ‘; G-AGAAGGCTGGGGCTCATTTG-3ʹ, GAPDH-R：5ʹ-AGGGGCCATCCACAGTCTTC-3 ‘. The 2^−ΔΔCT method was used to determine relative gene expression, which was normalized to the amount of GAPDH mRNA. All experiments were performed at least in triplicate for each gene. Data are expressed as the mean ± S.E.M.

Yang X., Wang S, & Reheman A. (2020). Regulation of RUNX3 Expression by DNA Methylation in Prostate Cancer. Cancer Management and Research, 12, 6411-6420.

+ Open protocol

+ Expand

Quantitative Analysis of HBV DNA and RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

HBV core DNA were obtained as described [30] (link). HBV genome DNA in mouse serum and liver were extracted by using Biospin Virus DNA Extraction Kit and Biospin Tissue Genomic DNA Extraction Kit, respectively. Absolute real-time PCR were quantified by FastStart Universal SYBR Green Master Mix (Roche) (Bio-Rad, CFX Connect Real-time System), the efficiency was 95–105%, r² > 99%. (the LOD = 40, LOQ = 1.0 × 10²)
Total RNA both cells and tissue were extracted using TRNzol Reagent (Invitrogen) according to the manufacturer's instructions. First-strand cDNA was synthesized from 1μg of RNA using the iScriptTM cDNA Synthesis kit (Bio-Rad). Relative RNA expression levels were quantified by FastStart Universal SYBR Green Master Mix (Roche) and β-actin mRNA was used as an internal control. Values were analyzed using the ^2-△△Ct method. (QuantStudio 6 Flex, appliedbiosystems).
The primer sequences of the experimental primers are listed in Supplementary Table.

Ren F., Yang X., Hu Z.W., Wong V.K., Xu H.Y., Ren J.H., Zhong S., Jia X.J., Jiang H., Hu J.L., Cai X.F., Zhang W.L., Yao F.L., Yu H.B., Cheng S.T., Zhou H.Z., Huang A.L., Law B.Y, & Chen J. (2019). Niacin analogue, 6-Aminonicotinamide, a novel inhibitor of hepatitis B virus replication and HBsAg production. EBioMedicine, 49, 232-246.

+ Open protocol

+ Expand

Isolating and Analyzing Circular RNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from whole-cell lysates or the nuclear and cytoplasmic fractions were isolated using TRNzol reagent (Invitrogen, Carlabad, CA, USA) for cultured cells or using the GeneJET RNA Purification Kit (Invitrogen, Carlabad, CA, USA) for fresh-frozen tissues. For RNase R treatment, 2 μg of total RNA was incubated for 20 min at 37 °C with or without 3 U/μg of RNase R (Epicentre Technologies, Madison, WI) in 1× RNase R reaction buffer, and the resulting RNA was purified using RNeasy MinElute cleaning Kit (Qiagen, Duesseldorf, Germany); this was transcribed into cDNA (Vazyme Biotech, Nanjing, China). Real-time PCR was performed in accordance with the manufacturer’s protocol, using the 2× SYBR Green qPCR Master Mix (Selleck, Shanghai, China). Before calculation using the 2^−ΔΔCt method, the GAPDH levels were used to normalize the relative expression levels of circRNA and linear mRNA, and the levels of small nuclear U6 were used to normalize the miRNA expression level. Primers used are as follows:
ASXL1: F: TCAGAGCAATGTTACAGGCCA, R: CTGTTCTCGGCATTTGCCTT;
Circ-ITGA7: F: GTGTGCACAGGTCCTTCCAA, R: TGGAAGTTCTGTGAGGGACG.

Yang G., Zhang T., Ye J., Yang J., Chen C., Cai S, & Ma J. (2019). Circ-ITGA7 sponges miR-3187-3p to upregulate ASXL1, suppressing colorectal cancer proliferation. Cancer Management and Research, 11, 6499-6509.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of cells and tissues were extracted with TRNzol Reagent (Invitrogen, Carlsbad, CA, United States). 500 ng RNA was reversed transcribed with PrimeScript RT reagent Kit (Takara, kyoto, Japan) following the manufacturer’s instructions. Quantitative Real-time PCR was performed with The SYBR Premix Ex Taq II Kit (Takara, kyoto, Japan) and CFX96 Real-Time PCR Detection System (Bio-Rad). Gapdh was the internal control for quantifying mRNA levels. All primers used in this study is shown in Table 1.

Jiang M., Liu Z., Shao J., Zhou J., Wang H., Song C., Li X., Wang L., Xu Q., Liu X., Lin L, & Zhang R. (2022). Estrogen receptor α regulates phenotypic switching and proliferation of vascular smooth muscle cells through the NRF1-OMI-mitophagy signaling pathway under simulated microgravity. Frontiers in Physiology, 13, 1039913.

+ Open protocol

+ Expand

Quantification of GOLPH3 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from each sample and cultured cells by using TRNzol reagent (Invitrogen, CA, USA). An additional DNase digestion procedure was included in the isolation of RNA to remove contaminating DNA and was performed according to the manufacturer's protocol. cDNA was synthesized using a First Strand cDNA Synthesis kit (Fermentas, Thermo Scientific, EU). qPCR was performed using SYBR Premix Ex Taq II (TaKaRa), and GAPDH was used as an internal control, then was performed using AriaMx Real-Time PCR (7300 Sequence Detection System, Applied Biosystems). The primer sequences used for each target gene were as follows: GOLPH 3, sense, 5'-ACATCCCCTCACCAATAACAAC-3'; antisense, 5'-TAGCCAAATCATACTGCTCGTC-3'; GAPDH, sense, 5'-GGTATCGTCGAAGGACTCATGAC-3'; antisense, 5'-ATGCCAGTGAGCTTCCCGTTCGC-3'. RT-qPCR was run at 95°C for 15 min followed by 40 cycles of 95°C for 10 s, 55°C for 30 s, and 72°C for 30 s. Data were collected during the cycles at 72°C. Relative gene expression was calculated using the comparative Ct method. All experiments were performed in triplicate.

Liu T., Jin Z.W., Li Y., Zhang G., Yang X.Y., Xu X.M, & Ma Y.C. (2022). Golgi phosphoprotein 3 promotes ovarian cancer progression and is associated with cisplatin resistance. Journal of cancer research and therapeutics, 18(2).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!