Genomic DNA was prepared from tissue (cerebrum, cerebellum, spinal cord, tail tips) or cells using the commercially available KAPA Mouse Genotyping Kit (Roche, #KK5621). Recombination and deletion of SOD2 floxed site was determined by PCR using purified Genomic DNA. In the case of SOD2, presence of an ~850 bp band signifies the flox allele, whereas a band at 786 bp denotes the wild‐type allele and a band at ~200 bp represents the recombined allele. The primer sequences are provided in Table S1 .
Kapa mouse genotyping kit
Manufactured by Roche
Sourced in United States
The KAPA Mouse Genotyping Kit is a laboratory equipment product designed for the purpose of genotyping mice. It provides a reliable and efficient method for identifying specific genetic traits or markers in mouse samples.
Automatically generated - may contain errors
Lab products found in correlation
Maxwell 16 mouse tail dna purification kit, by Promega (4 mentions)
Rosa26 tdtomato reporter mice, by Jackson ImmunoResearch (1 mentions)
C57bl 6 mice, by Charles River Laboratories (1 mentions)
Datirescre knock in mice, by Jackson ImmunoResearch (1 mentions)
B6 sjl slc6a3tm1.1 cre bkmn j, by Jackson ImmunoResearch (1 mentions)
Pcrbio hs taq mix red kit, by PCR Biosystems (1 mentions)
Atl buffer, by Qiagen (1 mentions)
C57bl 6j, by Janvier Labs (1 mentions)
Quickcalcs software, by GraphPad (1 mentions)
3730xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
C57bl 6jolahsd, by Inotiv (1 mentions)
B6 cg tg cdh5 cre 7mlia j, by Jackson ImmunoResearch (1 mentions)
C57bl 6j mice, by Jackson ImmunoResearch (1 mentions)
Gt rosa 26sortm1 cre ert2 tyj, by Jackson ImmunoResearch (1 mentions)
Atl lysis buffer, by Qiagen (1 mentions)
Proteinase k solution, by Thermo Fisher Scientific (1 mentions)
Crl 4000, by American Type Culture Collection (1 mentions)
Pcr blunt 2 topo plasmid, by Thermo Fisher Scientific (1 mentions)
Tie2 cre mice, by Jackson ImmunoResearch (1 mentions)
Nfatc1cre, by Jackson ImmunoResearch (1 mentions)
54 protocols using kapa mouse genotyping kit
1
Genotyping SOD2 Floxed Mice
2
Genotyping Mouse Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The KAPA2G Fast genotyping Mix (KAPA Mouse genotyping kit, Roche Diagnostics) was used for DNA extraction from mouse tissue samples followed by extraction lysis at 75°C for 10 min and 95°C for 5 min. The DNA extracts were diluted 10-fold with 10 mM Tris-HCl (pH 8.0–8.5). PCR: diluted extracts were mixed with PCR master mix (2XKAPA Genotyping Mix with dye), 10 μM Forward primer and 10 μM Reverse primer for human glucosyltransferase29 (link) and Actin (of mouse origin). Cycling protocol for PCR: initial denaturation at 95°C for 3 min, 40 cycles of denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, and extension at 72°C for 15 sec/kb, and a final extension at 72°C for 1 min. The PCR extracts were separated by 2% agarose gel electrophoresis. All breeder pairs were tested positive for Leb-transgenicity by PCR.
3
Genetic Manipulation of Dopaminergic Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adult male 8–16 week old C57BL/6 mice (Charles River Laboratories, Senneville, Quebec, Canada), TH-IRES-Cre knock-in mice (gift from Dr. Antoine Adamantidis, McGill University, Canada –source; EM: 00254;B6.129 × 1-Thtm1(cre)Te/Kieg; European Mouse Mutant Archive), DAT-IRES-Cre knock-in mice (Jackson Labs, Bar Harbor, Maine, USA; B6.SJL-Slc6a3tm1.1(cre)Bkmn/J), ROSA26 tdTomato reporter mice (Jackson labs; B6.Cg-Gt(ROSA)26Sortm14(CAG-TdTomato)Hze/J (Ai14)) were used in the study. We then crossed the lines to obtain TH-IRES-Cre homozygous, DAT-IRES-Cre-Ai14 heterozygous mice. Pairs of homozygous DAT-IRES-Cre (female) or Ai14 (ROSA26tdTomato; male) genotypes were mated, and the resulting heterozygous DAT-IRES-Cre-Ai14 male offspring were used in subsequent experiments. All mice were genotyped using DNA extracted from ear notches using the Kapa mouse genotyping kit (Kapa Biosystems, Roche Canada, Mississauga, Ontario, Canada) according to manufacturer’s instructions. Genotyping of the TH-IRES-Cre, DAT-IRES-Cre, reporter Ai14 and DAT-IRES-Cre-Ai14 mice were performed in a similar manner, using the primers recommended by the supplier (Jackson Labs, Bar Harbor, Maine, USA). All mice were housed on a 12:12 hour light: dark schedule (lights on at 07:00 – off at 19:00) with ad libitum access to food and water.
4
Cep250 Knockout Allele Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase chain reaction (PCR) was used to identify the Cep250 KO allele using primers listed in Table 1 and the KAPA Mouse Genotyping Kit (KR0385; Kapa Biosystems) or the 2x PCRBIO HS Taq Mix Red Kit (PB10.23.02; PCR Biosystems, London, UK).Thermal cycling conditions were primary denaturation at 94°C for 10 minutes; 40 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and DNA extension at 72°C for 30 seconds; and a final extension cycle at 72°C for 5 minutes.
5
Extraction of DNA from Mouse Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from mouse tails at 3-week-old for genotyping was extracted using KAPA Mouse Genotyping Kit (KAPA Biosystems, Wilmington, MA). DNA from sperm was extracted as previous described [10 (link), 41 (link)]. Briefly, sperm were collected by centrifugation at 500 g for 5 minutes then resuspended in 300 μL ATL buffer (Qiagen, Hilden, Germany) containing 0.55 mg/mL Proteinase K and 30 mM DTT and incubated overnight at 55°C. The samples were then mixed with 90 μL of 5 M NaCl and centrifuged at 13,000 g for 10 minutes. The supernatant was transferred to a new tube, mixed with 390 μL ethanol and placed at −20°C for 1 hour. The DNA was then pelleted by centrifugation at 13,000 g for 10 minutes, washed with 70% ethanol and dissolved in TE buffer at 55°C for 15 minutes. DNA was isolated from the organs of 6-month old male mice using a Maxwell 16 Mouse Tail DNA Purification kit (Promega, Madison, WI) according to the manufacturer’s instructions. A 5 cm region of the jejunum starting 10 cm downstream of stomach was used as the small intestinal sample and the DNA was isolated from this segment as described above for intact organs.
6
Genotyping Mice DNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from mice ear punches using 180 μl of 50 mM sodium hydroxide per 5 to 10 mg of mouse ear sample and incubated for 10 minutes at 95° C. Extract was neutralized by adding 20 μl of 1M Tris- hydrochloride (pH 8.0). Genotyping was performed using KAPA Mouse Genotyping Kit (KAPA Biosystems). Genotyping primers targeting the WT or KI alleles are reported in Table S1 (available at https://www.ophthalmologyscience.org ).
7
Genotyping Mouse Alleles by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genotype of WT (+/+), homozygous KO (−/−) and heterozygous (+/−) mice was determined by polymerase chain reaction (PCR) using primers for sequences within exon 2 (Figure 3A ). Deletion of 10 bp (GATGGACGAT) from exon 2, is predicted to cause a frame-shift after amino acid 31 and the addition of 3 extraneous amino acids at the C terminus of the truncated protein (Figure S4 ). The different alleles were identified by isolating genomic DNA from ear or tail snips. Primers with the following sequences were designed to amplify the regions flanking the deletion in exon 2: 5ʹ-CATCTCCGGCTAAACATCGGGC-3ʹ and 5ʹ-CTGAGCTACCACCACG ATATC-3ʹ. Using these primers, we amplified a 53 bp fragment from the WT allele and a 43 bp fragment from the deleted allele (Figure 3B ). DNA amplification was performed using an initial denaturation (95°C for 3 min) followed by 25 cycles of denaturation (95°C, 15 s), annealing (60°C, 15 s) and extension (72°C, 5 s). To extract the genomic DNA and for PCR reactions, we used the KAPA Mouse Genotyping Kit (KAPA Biosystems). PCR products were separated using 5% agarose gels.
8
Genotyping Conditional Transgenic Mouse Lines
9
Genotyping Mouse Alleles by PCR
10
Genetic Analysis of Syk Conditional KO Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using the KAPA Mouse Genotyping Kit (Kapa Biosystems, Clinisciences, Nanterre, France) according to the manufacturer’s instructions. For detection of the Wap-Cre transgene, the forward primer W003 (AGCTGTGCCAGCCTCTTC) and the C031 antisense primer (CATCACTCGTTGCATCGACC) were used. For detection of the floxed Syk allele, the Ef forward (TGTGACCCAGCATGTGTTTT) and the Er reverse (CATGCATTAGCAGGAAAACCT) primers, or the Lf forward (CGCCCTTGAGGACTGTGTCCA) and Lr reverse (CCCACGGTCTCCCAACACACA) primers were used. The Lf-Er primer combination was used to verify the excision of exon 2 and exon 3 of the Syk gene in the mammary glands of Wap-Cre;Sykfl/fl Syk cKO mice.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!