Dynamo hs sybr green qpcr master mix

Cell pellets from 6 mL of culture grown in glucose + arabinose medium for 24 h were used for RNA isolation. RNA was isolated individually from triplicate cultures of C. beijerinckii strains (_M1GS^DisA, _M1GS^CcpA, _M1GS^DisA16, _ΔM1GS^DisA16, or _pMTL500E). Each cell pellet was suspended in 1 mL of TRI Reagent (Sigma, St. Louis, MO, United States) and lysed by passing through Tissue Lyser LT (Qiagen, Hilden, Germany) at maximal oscillation for 2 min. Subsequent RNA isolation steps were performed as per manufacturer’s instructions. Reverse transcription of RNA was carried out with 2 μg of total RNA using random hexamers and M-MLV Reverse Transcriptase (Promega, Madison, WI, United States). Quantitative PCR (20 μl final volume) was then conducted with DyNAmo HS SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, United States), using gene-specific primers (Table 1) for M1 RNA (M1-F & R), ΔM1RNA (M1p3-F & M1p12-R), CcpA (Cbei_0047- F & R), and DisA (Cbei_0127- F & R). Each of the triplicate RNA preparations was analyzed twice in a BioRad iCycler continuous fluorescence detection system (BioRad, Hercules, CA, United States), with the following cycling conditions: 95°C – 15 min; 40 cycles of 95°C – 10 s and 55°C – 60 s. The levels of respective RNAs were normalized to 16S rRNA (Zhang and Ezeji, 2013 (link)).

Total RNA was prepared from the whole brain of adult HeJ, FeJ, and FeJ-Gria4^IAP and the hippocampus of adult FeJ- Gria4^IAP either wildtype or carrying Pcnxl2 TALEN mutations with Trizol (Invitrogen) and treated with DNase I (Promega) under the manufacturer's suggested conditions. RNA (2 µg) was reverse transcribed with AMV reverse transcriptase (Promega). The cDNA was diluted 20-fold, and 2 µl was added to DyNAmo HS SYBR Green qPCR master mix (Thermo Scientific) with pairs of the following primers; beta-actinF (5′- ATGCTCCCCGGGCTGTAT-3′) and beta-actinR (5′- CATAGGAGTCCTTCTGACCCATTC-3′), Pcnxl2exon19F (5′-GGATCTCACATCCTGTGCTC -3′) and Pcnxl2exon20R (5′-CCACACGTAGAGTCTCTCAAAC -3′), Gria4exon15F (5′- GGTGGCTTTGATAGAGTTCTGTTACA-3′) and Gria4exon16R (5′- TCTTATGGCTTCGGAAAAAGTCA -3′), Pcnxexon35F (5′-GAACAGCTGGAAAGACTGGA-3′) and Pcnxexon36R (5′-CGATGTGGGACCTTGTACTT-3′). The PCR reactions were analyzed on an Applied Biosystems 7500 Real-Time PCR System. The PCR amplifications from three mice of each strain and/or genotype were run in triplicate. Amplification of the correct size products was confirmed by agarose gel electrophoresis. The ΔΔΧt method was adopted for the calculation of relative transcript levels.