Axyprep bacterial genomic dna miniprep kit
The AxyPrep bacterial genomic DNA miniprep kit is a laboratory equipment product designed for the rapid and efficient extraction of high-quality genomic DNA from bacterial samples. It provides a simple and reliable method for isolating DNA suitable for various downstream applications.
Lab products found in correlation
33 protocols using axyprep bacterial genomic dna miniprep kit
Genome sequencing of novel bacterial strains
Bacterial 16S rRNA Gene Sequencing and Phylogenetic Analysis
Bacterial Genomic DNA Extraction and PCR Amplification
Whole-Genome Sequencing and Assembly of Bacterial Strains
Listeria monocytogenes Genomic DNA Isolation and PCR
For PCR, a 50-μl solution comprising 1× FIREPol® Master Mix Ready to Load (12.5 mM MgCl2; Solis BioDyne, Tartu, Estonia), 2-μl listeriolysin O gene primer mix (50 pmol), 5-μl DNA template (50 μg/ml), and 33-μl of ultrapure water was used. DNA was amplified in a MULTEGENE thermal cycler (Labnet International, Inc. Edison, NJ) as follows: 95°C, 10 min; followed by 35 sequential cycles of 94°C for 1 min, 52°C for 1 min, 72°C for 1 min; and a final elongation step at 72°C for 10 min was performed after the completion of the cycles. The amplified PCR products, along with a 1-kb DNA ladder (GeneCraft), were separated on a 1.5% agarose gel (Sigma–Aldrich) containing Ethidium Bromide (0.5 mg/ml, ROTH) by electrophoresis (30 min at 100 V in 10× Tris-Borate-EDTA buffer; BIO Basic, Inc.), and visualized using a visual image analyzer software (Syngene).
Genomic Analysis of Multidrug-Resistant Providencia rettgeri
Bacterial Genomic DNA Extraction
Molecular Detection of Florfenicol Resistance Genes
Primer sequences and PCR product sizes of the florfenicol resistance genes
Primer | Sequence (5′–3′) | Amplicon size (bp) | Annealing temperature (°C) | References |
---|---|---|---|---|
floR1-F | ATGACCACCACACGCCCCGCGTGGGC | 1198 | 58 | [7 (link)] |
floR1-R | CTTCGATCCCGCGACGTTCCTTCCGAGA | |||
fexA1-F | CTCTTCTGGACAGGCTGGAA | 332 | 57 | [6 (link)] |
fexA1-R | CCAGTTCCTGCTCCAAGGTA | |||
fexB1-F | ACTGGACAGGCAGGCTTAAT | 319 | 57 | [8 (link)] |
fexB1-R | CCTGCCCCAAGATACATTGC | |||
cfr1-F | GGGAGGATTTAATAAATAATTTTGGAGAAACAG | 580 | 58 | [7 (link)] |
cfr1-R | CTTATATGTTCATCGAGTATATTCATTACCTCATC | |||
optrA1-F | CTTATGGATGGTGTGGCAGC | 309 | 56 | [11 (link)] |
optrA1-R | CCATGTGGTTTGTCGGTTCA | |||
pexA1-F | GTTGTGGTCTTTGGCCAGAG | 318 | 56 | [9 (link)] |
pexA1-R | TCCATCAAGAGGACACCACC |
Bacterial Genomic DNA Extraction and Sequencing
Profiling Antibiotic Resistance Genes in Bacterial Isolates
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!