For quantitative real-time-PCR assays, total RNA was purified using SV Total RNA Isolation (Promega, Madison, WI, USA) and its integrity was assessed by capillary electrophoresis (Agilent, Santa Clara, CA, USA). RNA (400 ng) was converted to cDNA using random primers and Superscript III (Invitrogen, Carlsbad, CA, USA). Amplification was carried out in triplicates with a 7900HT Fast Real Time PCR System (Applied Biosystems) using the Fast SYBR Green RT-PCR kit (Applied Biosystems) and a standard 2-step protocol. The primers specific for each gene were designed and analysed with Primer3 (freeware) and Vector NTI (Invitrogen, freeware). Identity of the amplicons was confirmed by their dissociation profiles and gel analysis. Quantitative PCR standard curves were constructed by using serial dilutions of muscle cDNAs, using at least four dilution points and the efficiency of all primer sets was between 1.8 and 2.2. The data were normalized against Rplp0 housekeeping gene. Primers are listed in Supplementary Table 2 .
Sv total rna isolation
Manufactured by Promega
Sourced in United States
The SV Total RNA Isolation is a laboratory equipment product designed to facilitate the extraction and purification of total RNA from various sample types. It utilizes a simple and efficient silica-membrane-based technology to capture and concentrate RNA molecules, allowing for high-quality RNA isolation. The core function of this product is to provide a reliable and consistent method for researchers to obtain pure RNA samples for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Vector nti, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Fast sybr green rt pcr kit, by Thermo Fisher Scientific (1 mentions)
Abi prism 7300 system, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Ssofast evagreen supermix, by Bio-Rad (1 mentions)
Iq5 real time pcr detection system, by Bio-Rad (1 mentions)
Goscript reverse transcription, by Promega (1 mentions)
Rnalater buffer, by Qiagen (1 mentions)
Nanodrop 2000, by Promega (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Goscript reverse transcription system, by Promega (1 mentions)
Vacutainer, by BD (1 mentions)
Ribo zero plant, by Illumina (1 mentions)
Truseq stranded total rna library preparation kit, by Illumina (1 mentions)
7 protocols using sv total rna isolation
1
Quantitative Real-Time PCR Protocol
2
Quantitative Real-Time PCR Analysis of Human Muscle Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen tissue was homogenized and total RNA from human muscle tissue was isolated according to the manufacturer's instructions of SV Total RNA Isolation (Promega, Mannheim, Germany). RNA samples were stored at −80°C until assayed.
Complementary DNA (cDNA) synthesis was done according to manufacture manual (High Capacity RNA‐tocDNA Kit; Applied Biosystems, Foster City, CA). Samples were analyzed in triplicate with Power SYBR Green PCR Master Mix (Applied Biosystems). Real‐time quantitative polymerase chain reaction was performed using an ABI PRISM 7300 System (using SDS 1.4 system software, Applied Biosystems). The expression level of cyclophyllin A was used as an internal control. Primer sequences of analyzed genes are available on request. Cycle threshold values were used to calculate the amount of amplified polymerase chain reaction product in comparison to the housekeeping gene cyclophyllin A. The relative amounts of each transcript were analyzed using the 2−ΔC(t) method.
Complementary DNA (cDNA) synthesis was done according to manufacture manual (High Capacity RNA‐tocDNA Kit; Applied Biosystems, Foster City, CA). Samples were analyzed in triplicate with Power SYBR Green PCR Master Mix (Applied Biosystems). Real‐time quantitative polymerase chain reaction was performed using an ABI PRISM 7300 System (using SDS 1.4 system software, Applied Biosystems). The expression level of cyclophyllin A was used as an internal control. Primer sequences of analyzed genes are available on request. Cycle threshold values were used to calculate the amount of amplified polymerase chain reaction product in comparison to the housekeeping gene cyclophyllin A. The relative amounts of each transcript were analyzed using the 2−ΔC(t) method.
3
Quantification of IFNβ Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated at 4 hours post infection to generate cDNA using the SV total RNA isolation and GoScript reverse transcription systems, respectively, from Promega. Gene expression was measured by qPCR using SsoFAST EvaGreen Supermix (BioRad) on the iQ5 Real-Time PCR Detection System (BioRad), and normalized to the expression of ribosomal 18S RNA. Primer sequences used were as follows: ifnβ forward (ATGAGTGGTGGTTGCAGGC) and reverse (TGACCTTTCAAATGCAGTAGATTCA), and 18S rRNA forward (CTTAGAGGGACAAGTGGCG) and reverse (ACGCTGAGCCAGTCAGTGTA).
4
Spinal Cord Injury RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Spinal cord fragments around the injury were cut out from the vertebra after the rats were sacrificed. Then, the fragments were maintained in RNAlater buffer (Qiagen) until total RNA extraction. Another group of animals treated in parallel was used for histopathology.
Total RNA was extracted by SV Total RNA Isolation (Promega USA), and the concentration and purity were determined using a Nanodrop2000 spectrophotometer. RNA integrity was determined using agarose gel electrophoresis.
Total RNA was extracted by SV Total RNA Isolation (Promega USA), and the concentration and purity were determined using a Nanodrop2000 spectrophotometer. RNA integrity was determined using agarose gel electrophoresis.
5
Maxilla RNA Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Maxilla samples were stored in Trizol (Thermoficher, Sao Paulo, Brazil) at −70 °C. Total RNA (1.0 mg) was transcribed (SV TOTAL RNA isolation, PROMEGA, São Paulo, Brazil). The real-time polymerase chain reaction was performed using primers specific for IL-1β and iNOS. Cycling conditions were: Denaturation at 95 °C for 5 min, then cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s; samples were run 40 times at 95 °C for 30 s for denaturation of cDNA, 60 °C for 30 s, and cDNA annealing at 72 °C for 30 s. The threshold cycle value for each reaction was recorded and analyzed using the Bio-Rad IQ5Real-Time (Sybr green, Thermoficher, Sao Paulo, Brazil) Software Detection System with the 2−ΔΔCt method used for relative quantification.
6
Isolation and Analysis of White Blood Cell RNA in ARDS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were taken prior to oleic-acid injection and after ARDS was apparent, as described earlier. Blood was collected in EDTA blood collection tubes (BD Vacutainer; Becton Dickinson, NJ), centrifuged, and plasma was frozen at -80 °C. Red blood cells were lysed with ammonium chloride solution (155 mM NH 4 Cl, 10 mM KHCO 3 , 0.1 mM EDTA, pH 7.3) and total RNA was extracted from white blood cells (WBC) using Spin column extraction (SV Total RNA Isolation (Promega, Madison, WI). Briefly, the cell pellet was lysed in RNA lysis buffer, loaded onto spin columns, and purified by a series of centrifugations. Total bound RNA was eluted with H 2 O. Purity and concentration were determined using NanoDrop Spectrophotometer (Thermo Fisher Scientific; Waltham, MA) at wavelengths 230, 260, and 280 nm. cDNA was synthesized by reverse transcription (GoScript™ Reverse Transcription System by Promega, Madison, WI). cDNA purity and concentration were determined and samples were used for PCR or kept frozen at -80 °C.
7
RNA-seq of Pea LATE3 Genotypes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA sequencing from isogenic late3-1 and LATE3 genotypes was performed on RNA pooled from entire embryos isolated from seeds 2 d after imbibition and leaves and shoot apices from 4-week-old plants. Samples were harvested from three plants in two independent replications, and one replication was used for cDNA library construction. Samples from the three different tissues were used for RNA extraction according to SV total RNA isolation (Promega). One microgram of total RNA from each of the three tissues was pooled for preparation and indexing cDNA library using the TruSeq Stranded Total RNA library preparation kit with Ribozero Plant (Illumina). Pools of indexed cDNA libraries of about 260 bp diluted to 6 pM were then used for sequencing in a Miseq nextgeneration sequencing machine using Miseq Reagent v3 150 cycles kit (Illumina). Quality of the reads generated was assessed in FASTQC in galaxy (Giardine et al., 2005) . Paired-end reads were aligned to pea transcript sequences located within the defined interval of PsLGIII (Supplemental Table S3) in Geneious 8.0.4 software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!