Standard bacterial cloning methods were used (Ausubel et al., 1987 ). Plasmid DNA was prepared using Qiagen kits according to the manufacturer's instructions. Modifications for Gram-positive strains included growing bacteria in medium supplemented with 0.5% glycine, and using mutanolysin and lysozyme to facilitate cell lysis. For transformation of E. coli, cells were made chemically competent with CaCl2. Naturally competent streptococcal species were transformed (Lawson and Gooder, 1970) using horse serum. For noncompetent Gram-positive species, cells were grown in 1% or 4% glycine for streptococcal or enterococcal strains, respectively, and electroporated with closed circular plasmid (Flannagan and Clewell, 1991 (link)). All genetic constructs were confirmed by nucleotide sequence analysis. Strains with chromosomal insertions were further verified by Southern blot analysis using digoxigenin-labeled probes (Roche Diagnostics Corporation, Indianapolis, IN) according to the manufacturer's directions.
Digoxigenin labeled probe
Manufactured by Roche
Sourced in Germany
Digoxigenin-labeled probes are synthetic DNA or RNA sequences that have been chemically modified to incorporate the organic compound digoxigenin. This modification allows the probes to be detected using specific antibodies or other detection methods. The core function of these probes is to serve as molecular markers for the identification and localization of target sequences in various biological samples, such as DNA, RNA, or chromosomes.
Automatically generated - may contain errors
Lab products found in correlation
Anti digoxigenin antibody, by Roche (2 mentions)
Double digoxigenin labeled probes, by Qiagen (2 mentions)
Ish buffer, by Qiagen (2 mentions)
S1 nuclease, by Takara Bio (1 mentions)
Fp1170, by PerkinElmer (1 mentions)
X ray film, by GE Healthcare (1 mentions)
Cdp star ready to use, by Roche (1 mentions)
Chef dr 2 system, by Bio-Rad (1 mentions)
λ dna mono cut mix, by New England Biolabs (1 mentions)
S1 nuclease, by Thermo Fisher Scientific (1 mentions)
Rna labeling kit, by Roche (1 mentions)
Nbt bcip mix, by Roche (1 mentions)
Pgem t vector, by Promega (1 mentions)
Cdp star substrate, by Roche (1 mentions)
11 protocols using digoxigenin labeled probe
1
Bacterial Cloning Methods for Transformation
2
Detecting mcr-1 Gene in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mcr-1-positive samples we obtained were kept in LB broth or on LB agar with appropriate antibiotics. E. coli C600 was used as the recipient for the conjugation experiment of MCR-producing E. coli isolates. The trans-conjugants were selected on MacConkey agar containing colistin (2 μg/ml) and streptomycin (2000 μg/ml) and finally confirmed by PCR and ERIC-PCR. To analyze the location of the mcr-1 gene, S1-PFGE and Southern blot analysis were performed using the original strains and trans-conjugants carrying mcr-1 gene. Briefly, whole-cell DNA of the E. coli strains were extracted and embedded in agarose gel plugs. Subsequently, the agarose gel plugs were treated with S1 nuclease (TaKaRa, Dalian, China), and the DNA fragments were separated by PFGE. Southern blot hybridization was then performed with the digoxigenin-labeled probes (Roche Diagnostics, Mannheim, Germany) specific for the mcr-1 gene.
3
In Situ Hybridization of CADM1-AS1 in HCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess the expression pattern of CADM1-AS1 in HCC, in situ hybridization was performed with double digoxigenin-labeled probes (Exiqon, Vedbaek, Denmark) according to the manufacturer’s instruction. Briefly, HCC tissue samples were sectioned at 5 μm and deparaffinized, then treated with proteinase-K (5 μg/ml) for 2 min at 37 °C. Slides were prehybridizated with the 1 × ISH buffer (Exiqon) and the samples were hybridized with digoxigenin-labeled probes at 50 °C for 1 h. Next, the slides were incubated with anti-digoxigenin antibody (Roche Diagnostics, IN) at 4 °C overnight. The probe sequence for CADM1-AS1 was 5ʹ-TCAGCCATAGTGCATAGCTACT-3′. Staining intensity was scored as 0 (negative), 1 (weak), 2 (medium) and 3 (strong). The staining extent was scored as 0 (10%), 1 (11–25%), 2 (26–50%), 3 (51–75%) and 4 (76–100%). These two subscores were then multiplied to obtain a final staining index. Low CADM1-AS1 expression was defined as a staining index of ≤3, whereas high CADM1-AS1 was >3 as described in our previous study.
4
In Situ Hybridization of Mouse DRG
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA probes were synthesized with gene-specific PCR primers and cDNA templates from mouse DRG. In situ hybridization was performed with digoxigenin-labeled probes (Roche, cat# 11277073910). Probes were incubated with the slides overnight at 55°C and the slides were then incubated with the horseradish peroxidase-conjugated anti-digoxigenin antibody 1:500 (Roche, Cat#11207733910; RRID:AB_514500 ). Final detection was achieved with TSA-Cy3 at a dilution of 1:50 (Perkin Elmer Life Sciences, FP1170). The oligonucleotides used for the nested PCRs and for probe synthesis are listed in the key resources table .
5
Chicken FGFR2 and FGFR3 cDNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chicken cDNA fragments for FGFR2 and FGFR3 were isolated by PCR using primers (5′-3′): FGFR2-F, TTTACGCGTGAGAGCGTAGTCCCATCCGA; FGFR2- R, TGAGCTAGCTCATTTTGGATCCTCTGGCAGTTC; FGFR3- F, ATAGATATCATGTCTGAGGCGGGCGGCGG; FGFR3-R, ATAGATATCTCAGATGAAGAGGACTAAGCCAG. cDNAs of LIM1, PEA3, FGF4 and FGF8 were gifts of Drs H. Nakamura and K. Tamura (Tohoku University). cDNAs of SEF and FGFR1 were isolated by Dr E. Shimokita (Nara Institute of Science and Technology, NAIST). Digoxigenin-labeled probes were prepared according to the manufacturer's instructions (Roche). Whole-mount in situ hybridizations were performed as previously described (Tonegawa et al., 1997 (link)).
6
mcr-1 Gene Dissemination via IncX4 Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the association of the IncX4 plasmid and the mcr-1 gene, all IncX4 plasmids harbouring mcr-1 were analyzed by S1-PFGE and Southern blotting with the digoxigenin-labeled probes (Roche Diagnostics GmbH, Germany) specific for the taxC and mcr-1 genes30 (link), 41 . Furthermore, the transferability of the mcr-1 gene was assessed in all the mcr-1-carrying isolates by filter mating using streptomycin-resistant E. coli C600 as a recipient. Briefly, donor bacterium and recipient was grown in Luria Bertani Broth (LB) to logarithmic phase, mixed at a 1:4 ratio (vol/vol), collected in a filter, and incubated at 37 °C for 20 h. Transconjugants were selected on Eosin-methylene blue agar plates supplemented with streptomycin (2000 µg/mL) and colistin (2 µg/mL). The transconjugants acquiring the mcr-1 gene were confirmed by both PCR and antimicrobial susceptibility test. Incompatibility (Inc) groups were assigned by PBRT and the revised IncX typing procedure for the wild isolates and their transconjugants3 (link), 5 (link), 42 (link).
7
Plasmid-Chromosome Localization of blaNDM-6
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA embedded in agarose plugs was digested using 50 units S1-nuclease (Thermo Fisher Scientific, Waltham, MA, United States) per plug slice and followed by pulsed-field gel electrophoresis (PFGE). Samples were run on a CHEF-DR II system (Bio-Rad, Munich, Germany) for 17 h at 6 V/cm and 14°C, while initial and final pulses of 4 and 16 s, respectively, were applied. The Lambda PFG and λ DNA-Mono Cut Mix (New England Biolabs, Frankfurt, Germany) were used as markers. Southern blot hybridization was performed to determine the plasmid/chromosomal location by hybridization with digoxigenin-labeled probes (Roche, Mannheim, Germany). A blaNDM-6 specific probe was generated and the chromosomal location was shown by colocalization with a blaOXA-51-like probe. Signal detection was performed using CDP-Star® ready-to-use (Roche) chemiluminescent substrate by autoradiography on X-ray film (GE Healthcare, Buckinghamshire, United Kingdom).
8
In Situ Hybridization of PVT1 in PDA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To explore the expression pattern of PVT1 in PDA, in situ hybridization was conducted with double digoxigenin-labeled probes (Exiqon, vedbaek, Denmark) according to the manufacturer’s instruction. Briefly, the PDA tissues were sectioned at 4 μm thick and deparaffinized, then treated with proteinase-K (20 μg/ml) for 10 min at 37 °C. Slides were prehybridizated with the 1 × ISH buffer (Exiqon) and then hybridizated with digoxigenin-labeled probes at 45 °C for 1 h. Afterwards, the slides were incubated with anti-digoxigenin antibody (Roche Diagnostics, IN) at 4 °C overnight, and then stained with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate. The sequences of the probes are as follows: PVT1 probe: 5’-AACAGGGCAGGATCTATGGCAT-3′ and scramble probe: 5’-GTGTAACACGTCTATACGCCCA-3′.
9
In Situ Hybridization Protocols for ubr3 and ptch2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ubr3 in situ hybridization probes I and II anti-sense sequences contain 2558 to 3576 nt and 3775 to 4770 nt of ubr3 cDNA, respectively. Anti-sense sequences were cloned into pGEM-T vector (Promega). Before transcription, the construct was linearized by SalI. ubr3 RNA in situ probes were transcribed and labeled with a digoxigenin [113 (link)] RNA labeling kit (Roche). In situ hybridization to whole-mount discs was performed as previously described [117 (link)]. Probe I was used in images shown in Fig 2F, 2G, 2H and 2I and S6J Fig . Probe II was used in images shown in Fig 2E and 2J and S2I , S6F, S6H and S6I Figs.
Zebrafish whole-mount in situ hybridization was carried out as described with minor modifications [118 (link)]. Digoxigenin-labeled probes were prepared according to manufacturer´s instructions (Roche). Probe signal was detected using NBT/BCIP mix (Roche). The ptch2 probe was kindly shared by Stone Elworthy (University of Sheffield, UK).
Zebrafish whole-mount in situ hybridization was carried out as described with minor modifications [118 (link)]. Digoxigenin-labeled probes were prepared according to manufacturer´s instructions (Roche). Probe signal was detected using NBT/BCIP mix (Roche). The ptch2 probe was kindly shared by Stone Elworthy (University of Sheffield, UK).
10
Transgenic Fish Genomic DNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tail fins of adult transgenic fish were amputated using a razor edge and then transferred to lysis buffer containing 0.1 μg/μl Proteinase K. The sample was incubated at 55 °C overnight, followed by standard ethanol precipitation. Purified genomic DNA samples were digested with EcoRl, which cleaves the plasmid reporter once. Southern blot hybridization was performed using a digoxigenin-labeled probe (Roche Diagnostics, Basel, Switzerland) and standard methods. Uncropped scan of Southern blot is shown in Supplementary Fig. 4 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!