Mastercycler nexus gradient thermocycler

Manufactured by Eppendorf

Sourced in Germany

The Mastercycler Nexus Gradient thermocycler is a laboratory instrument designed for the amplification of DNA and RNA samples. It features a temperature gradient function that enables simultaneous optimization of reaction conditions across multiple samples.

Automatically generated - may contain errors

Lab products found in correlation

Paxgene blood rna kit, by Qiagen (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Biodrop lite, by Harvard Bioscience (1 mentions) Genejet rna purification kit total rna purification protocol, by Thermo Fisher Scientific (1 mentions) Sequencing analysis software v6, by Thermo Fisher Scientific (1 mentions) Seqstudio 3200 genetic analyzer, by Thermo Fisher Scientific (1 mentions) Amplitag gold dna polymerase, by Thermo Fisher Scientific (1 mentions) Zymoclean gel dna recovery kit, by Zymo Research (1 mentions) Thermo scientific genejet pcr purification kit, by Thermo Fisher Scientific (1 mentions) Hotstartaq master mix, by Qiagen (1 mentions) Typhoon fla 9000, by GE Healthcare (1 mentions) Ethidium bromide, by Merck Group (1 mentions)

Close spelling variants of this product

Mastercycler Nexus thermocycler Mastercycler Nexus Gradient Nexus Gradient Thermocycler Mastercycler gradient thermocycler Mastercycler nexus Nexus thermocycler Mastercycler thermocycler Nexus Gradient Mastercycler Gradient Gradient thermocycler

9 protocols using mastercycler nexus gradient thermocycler

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation was carried out with PAXgene™ Blood RNA kit (Qiagen) according to Manual Purification of Total RNA from Human Whole Blood Collected into PAXgene Blood RNA Tubes protocol. The quality and integrity of the total RNA were assessed by visualization of the 28S/18S/5.8S rRNA band pattern in a 1.2% agarose gel. Electrophoreses were carried out at 95 V for 20 min in TBE buffer (Tris – Boric Acid – EDTA). 0.5 μg of total isolated RNA from each sample in volume 20 μl were used for cDNA synthesis by reverse transcription using the High–Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the procedures of producer on Mastercycler Nexus Gradient thermocycler (Eppendorf). To ensure the absence of genomic DNA contamination, negative controls were included in the reverse transcriptase reaction.
The qRT–PCR complied with the Minimum Information for Publication of Quantitative Real–time PCR Experiments (MIQE) guidelines. Gene transcripts – TET1, TET2, TET3, TDG, SLC23A1, SLC23A2 were analyzed by relative quantitative real–time RT–PCR (qRT–PCR) using relevant primers and short hydrolysis probes substituted with Locked Nucleic Acids from Universal Probe Library – UPL, see Supplementary information.

Linowiecka K., Guz J., Dziaman T., Urbanowska–Domańska O., Zarakowska E., Szpila A., Szpotan J., Skalska-Bugała A., Mijewski P., Siomek-Górecka A., Różalski R., Gackowski D., Oliński R, & Foksiński M. (2024). The level of active DNA demethylation compounds in leukocytes and urine samples as potential epigenetic biomarkers in breast cancer patients. Scientific Reports, 14, 6481.

+ Open protocol

+ Expand

Junction PCR Screening for Targeted Clones

Check if the same lab product or an alternative is used in the 5 most similar protocols

Clones were screened for targeting events by junction polymerase chain reaction (JPCR, Fig. 1d). One primer binding outside of the left homology arm (5’ HA, Fig. 1d) and the other primer binding inside the PAC gene were used to screen for clones that properly incorporated the PAC gene. Reactions were performed using a Mastercycler Nexus Gradient thermocycler (Eppendorf, Hauppauge, NY) with primers Sim1_Fwd_Junction1 and Puro_Reverse Junction1 (Table 1 and Fig. 1d) at 95 °C for 60s, followed by 35 cycles of 94 °C for 20s, 60 °C for 30s, and 72 °C for 120 s.

Xu H., Iyer N., Huettner J.E, & Sakiyama-Elbert S.E. (2015). A puromycin selectable cell line for the enrichment of mouse embryonic stem cell-derived V3 interneurons. Stem Cell Research & Therapy, 6, 220.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extractions were carried out according to the GeneJET RNA Purification Kit Total RNA Purification Protocol (Thermo Fisher Scientific Inc,, Waltham, MA, USA). RNA quality and quantity was analyzed spectrophotometrically using a BioDrop µLITE (BioDrop, Cambridge, UK, USA). The iScript cDNA Synthesis Kit for reverse transcription PCR (Bio-Rad Laboratories, Hercules, CA, USA) was used according to the manufacturer’s instructions using 360 ng of RNA and carried out in an Eppendorf Mastercycler Nexus Gradient thermocycler (Eppendorf, Hauppauge, NY, USA) according the reaction protocol provided by iScript.

Rousseau M.E., Sant K.E., Borden L.R., Franks D.G., Hahn M.E, & Timme-Laragy A.R. (2015). Regulation of Ahr signaling by Nrf2 during development: Effects of Nrf2a deficiency on PCB126 embryotoxicity in zebrafish (Danio rerio). Aquatic toxicology (Amsterdam, Netherlands), 167, 157-171.

+ Open protocol

+ Expand

Viral Heat Inactivation Temperature

Check if the same lab product or an alternative is used in the 5 most similar protocols

Clarified allantoic viruses, standardized to 128 HA units, were incubated in PBS for 40 min at temperatures ranging from 45 °C to 70 °C in a Mastercycler nexus gradient thermocycler (Eppendorf, Germany). After incubation, viruses were titrated by hemagglutination assay with 0.75% chicken erythrocytes. The temperature which resulted in a decrease of 6 log₂ units in the hemagglutination titer was taken as the temperature of HA heat inactivation [57 (link)].

Lyashko A.V., Timofeeva T.A., Rudneva I.A., Lomakina N.F., Treshchalina A.A., Gambaryan A.S., Sorokin E.V., Tsareva T.R., Adams S.E., Prilipov A.G., Sadykova G.K., Timofeev B.I., Logunov D.Y, & Gintsburg A.L. (2023). Antigenic Architecture of the H7N2 Influenza Virus Hemagglutinin Belonging to the North American Lineage. International Journal of Molecular Sciences, 25(1), 212.

+ Open protocol

+ Expand

Synthesis and Preparation of Oligonucleotide Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA and hybrid DNA/LNA oligonucleotides were synthesized with high-performance liquid chromatography purification by Integrated DNA Technologies (IDT) and Exqion, respectively. Reporter complexes were also labeled by IDT with 5′ TET fluorophores and 3′ Iowa Black FQ quenchers. Once received, the oligonucleotides were suspended in a 1× TE buffer (10 mM Tris—HCl, pH 8.0, 1 mM ethylenediaminete- traacetate (EDTA)). The stock concentrations were measured from their 260 nm absorbance using the extinction coefficients provided by IDT and Exqion. To minimize the loss from nonspecific binding, poly-T oligonucleotides were added to the dilute stock solutions (less than 1 μM) to reach a final poly-T concentration of 1 μM. Unless stated otherwise, chemicals and solvents were purchased from Sigma-Aldrich. The 10× TAE buffer (40 mM Tris, 40 mM acetate, 1 mM EDTA, pH 8.3–8.5) was purchased from Hoefer or Fisher Scientific. To reach a final concentration of 125 mM Mg²⁺, Mg(C₂H₃O₂)₂·4H₂O was added to the 10× TAE buffer. The oligonucleotide components were diluted to 30 μM in a 1× TAE buffer with 12.5 mM Mg²⁺ and then annealed at 95 °C for 5 min using a Eppendorf Mastercycler Nexus Gradient Thermocycler. Once annealed, the samples were cooled from 95 °C to room temperature over ∼90 min to form the substrates and reporters used in the below listed experiments.

Olson X., Kotani S., Yurke B., Graugnard E, & Hughes W.L. (2017). Kinetics of DNA Strand Displacement Systems with Locked Nucleic Acids. The journal of physical chemistry. B, 121(12), 2594-2602.

+ Open protocol

+ Expand

Mitochondrial DNA Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCR mixture contained 10× Gold buffer (Applied Biosystems, USA), 2 μL of 25 mM MgCl₂, 0.5 μL of 10 mM dNTPs, 0.5 + 0.5 μL of 10 μM L15995 + H16498, 0.2 μL of 5 U/μL AmpliTag Gold DNA polymerase (Applied Biosystems, USA), 0.1–1 ng of DNA, and H₂O to a final volume of 25 μL. The PCR program was as follows: 95 °C for 10 min, 40× (95 °C for 15 s, 55 °C for 30 s, 72 °C for 1 min), and 72 °C for 30 min.
PCR was performed using a MasterCycler Nexus gradient thermocycler (Eppendorf, Germany). The resulting amplicons were visualized using agarose gel electrophoresis. DNA clean-up of the amplified fragments excised from the gel was performed using a Zymoclean Gel DNA recovery Kit (ZymoResearch, USA). Sanger sequencing was performed using a SeqStudio 3200 Genetic Analyzer (Applied Biosystems, USA). Raw data processing was performed using Sequencing Analysis Software v6.0 (Applied Biosystems, USA).

Vankova L, & Vanek D. (2024). Capillary-Electrophoresis-Based Species Barcoding of Big Cats: CR-mtDNA-Length Polymorphism. Life, 14(4), 497.

+ Open protocol

+ Expand

DNA Methylation Profiling of Gene Promoters

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bisulfite sequencing was used to determine the percentage methylation at individual CpG sites within the Art3, Pcdhb6, Rsp16, Tspo, and Wnt16 promoters. Details of PCR conditions and primers are detailed in Table 2. Briefly, 1 µl of diluted bisulphite-treated DNA was added as a template in a PCR reaction using 10 µl Hot Star Taq mastermix (Qiagen), 1 µl of forward, and reverse primers (at a concentration of 10 pmol/µl) in a total volume of 20 µl. Amplification was carried out in a Mastercycler Nexus Gradient thermocycler (Eppendorf) using the following protocol; 95°C for 15 min, then 40 cycles of 95°C for 30 s, annealing temperature for 1 min, 72°C for 1 min, followed by 72°C for 5 min. Three microlitres of PCR product was used for visualization on a 1% agarose-TAE gel subjected to electrophoresis to confirm the presence of a PCR product. The remaining 17 µl PCR products were subsequently purified for sequencing using Thermo Scientific GeneJET™ PCR Purification Kit (Fisher Scientific, UK) to remove primers, dNTPs, and other impurities from the PCR product, according to the manufacturers’ instructions.

Kok D.E., Saunders R., Nelson A., Smith D., Ford D., Mathers J.C, & McKay J.A. (2024). Influence of maternal folate depletion on Art3 DNA methylation in the murine adult brain; potential consequences for brain and neurocognitive health. Mutagenesis, 39(3), 196-204.

+ Open protocol

+ Expand

DNA Aptamer and Origami Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA sequences, including FAM- and 5-carboxytetramethylrhodamine (TAMRA)-modified aptamers (TBA1: GGTTGGTGTGGTTGG and TBA2: AGTCCGTGGTAGGGCAGGTTGGGGTGACT), were purchased from Sigma-Aldrich with high-performance liquid chromatography–grade purity (Merck, Germany). The peptide substrates [FAM-GGfPR|SGGGK(BHQ-1)K-Aaa-OH with Aaa = G, K, or D] were purchased from Intavis Peptide Services GmbH (Germany). Human α-thrombin (2000 National Institutes of Health U/mg) was purchased by Cayman Chemical (#13188, Germany). DNA origami structures were designed with caDNAno (https://cadnano.org) and assembled using a 1:6 molar ratio between the M13mp18 ssDNA scaffold (40 nM) and each of the staple strands, in TEMg 1× buffer [20 mM tris, 2 mM EDTA, and 12.5 mM MgCl₂ (pH 7.6)]. Thermal annealing was performed by decreasing the temperature from 80° to 20°C at −1°C/min on a Thermocycler Mastercycler nexus gradient (Eppendorf), upon an initial denaturation at 80°C for 5 min. DNA origami samples were purified by polyethylene glycol precipitation. Their concentration was determined by quantitative polymerase chain reaction (qPCR) or spectrophotometrically (see below) and adjusted to the final desired value in the assay buffer before use for the enzymatic studies.

Kosinski R., Perez J.M., Schöneweiß E.C., Ruiz-Blanco Y.B., Ponzo I., Bravo-Rodriguez K., Erkelenz M., Schlücker S., Uhlenbrock G., Sanchez-Garcia E, & Saccà B. (2022). The role of DNA nanostructures in the catalytic properties of an allosterically regulated protease. Science Advances, 8(1), eabk0425.

+ Open protocol

+ Expand

DNA Origami Structural Assembly

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA origami structures were designed with caDNAno (www.cadnano.org) and assembled using a 1:50 molar ratio between the M13mp18 ssDNA scaffold (2 nM) and each of the staple strands, in 1× TEMg buffer. Thermal annealing was performed by decreasing the temperature from 80 °C to 20 °C at −1 °C/min on a Thermocycler Mastercycler nexus gradient (Eppendorf), upon an initial denaturation at 80 °C for 5 min. The reaction mixtures were then analyzed by agarose gel electrophoresis using 0.75% agarose (Biozym) in 1× TBEMg, at 80 V for 2 h at 4 °C. 1 kbp DNA ladder was purchased from Roth. The gel was scanned with a Typhoon FLA 9000 (GE healthcare Life Sciences) at different wavelengths and finally stained with ethidium bromide (Merck). The full list of sequences is provided in Supplementary Data 1.

Kosinski R., Mukhortava A., Pfeifer W., Candelli A., Rauch P, & Saccà B. (2019). Sites of high local frustration in DNA origami. Nature Communications, 10, 1061.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!