The quinolone resistance determining regions (QRDRs) of the gyrA, gyrB, parC, and parE genes were amplified using published primers (Table 1 ), as reported previously [16 (link)]. Positive and negative control was used to establish the validity of the PCR assay. PCR products were then sequenced in an automatic sequencer (ABI 3130; Applied Biosystems, Foster City, CA, USA) followed by detection of mutation using SeqScape v3 (ABI 3130; Applied Biosystems).
Seqscape v3
Manufactured by Thermo Fisher Scientific
Sourced in United States
SeqScape v3.0 is a software application designed for DNA sequence analysis. It provides tools for sequence alignment, visualization, and data management.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Abi 3130, by Thermo Fisher Scientific (1 mentions)
Abi 3730 dna analyzer, by Thermo Fisher Scientific (1 mentions)
Abi 3730xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Taqman snp genotyping assay, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator sequencing kit, by Thermo Fisher Scientific (1 mentions)
Bigdye direct cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Veriti 96 well thermocycler, by Thermo Fisher Scientific (1 mentions)
3130 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
3500 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3, by Thermo Fisher Scientific (1 mentions)
Sequence scanner v2, by Thermo Fisher Scientific (1 mentions)
Bigdye reagents, by Thermo Fisher Scientific (1 mentions)
9 protocols using seqscape v3
1
Quinolone Resistance Gene Sequencing
2
Sequencing and Variant Analysis of CSF1R Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CSF1R gene was sequenced in all 48 patients as follows. The entire coding region of CSF1R was PCR-amplified using flanking intronic primers (primer sequences available on request). The PCR product was purified and then sequenced in both directions using Big Dye Terminator V.3.1 Cycle Sequencing Kit (Applied Biosystems). Sequencing products were purified and read on an ABI 3730 DNA Analyzer (Applied Biosystems). Sequences were analysed using Seqscape V.3 software (Applied Biosystems). Variants are described with reference to Ensembl Transcript ENST00000286301 of the CSF1R gene. In silico prediction was performed using Polyphen-211 (link) and Provean.12 (link)
3
Sanger Sequencing of Pathogenic Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All variants detected as novel, pathogenic (P) and likely pathogenic (LP) obtained after the NGS study were confirmed by the Sanger 3500 Series Genetic Analyzers sequencing method (Applied Biosystem, ThermoFisher, Scientific, USA). DNA samples of 50 ng from the patients carrying these variants were amplified by PCR method with the targeted primers. Amplification products were paired-end sequenced with BigDye Terminator v3.1, in accordance with the manufacturer’s instructions. The data obtained were analyzed with SeqScape v3.0 and Sequencing Analysis v6.0 (ThermoFisher, Scientific, USA) software using the GRCh37/hg19 reference genome. Primer sequences are available under request.
4
Genetic Screening for Parkinsonism and Dementia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To exclude (possibly) pathogenic variants in other known genes causing parkinsonism or dementia (Supplementary Table 2 ) we performed whole exome sequencing (WES) and multiple ligation-dependent probe amplification (MLPA, P051-Parkinson mix 1) in the possibly pathogenic LRP10 variant carriers. WES was performed with the same protocol as previously reported in Jamra et al. (2017) [29 (link)]. An average depth of >84× was reached, with 99% of the target region covered >20×.
For copy number analysis, The P051-D1 Parkinson kit (MRC Holland) was used according to the manufacturer’s protocol. An ABI 3730XL Genetic Analyzer (Thermo Fisher Scientific) and Seqscape v3.0 (Thermo Fisher Scientific) were used for analysis. APOE genotyping was performed using TaqMan® SNP Genotyping Assay (Thermo Fisher Scientific).
For copy number analysis, The P051-D1 Parkinson kit (MRC Holland) was used according to the manufacturer’s protocol. An ABI 3730XL Genetic Analyzer (Thermo Fisher Scientific) and Seqscape v3.0 (Thermo Fisher Scientific) were used for analysis. APOE genotyping was performed using TaqMan® SNP Genotyping Assay (Thermo Fisher Scientific).
5
Identifying Novel Allele Verification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Considering the marker 4910 present in Panel 2017, an off-bin and off-ladder peak between allele 4 and 10 was observed in 36 of all evaluated samples. To verify the existence of a new, previously unreported allele, a single PCR reaction for three homozygous samples was performed followed by a Sanger sequencing procedure. For PCR amplification, cycling sequencing, and sequencing, the same instruments described above were used. BigDye® Terminator Sequencing Kit (Thermo Fisher Scientific Inc., MA, USA) was used according to manufacturer protocol. Run conditions are as follows: oven temperature at 55 °C; pre-run 15 kV, 180 s; injection 1.2 kV for 12 s; run 15 kV, 1700 s; capillary length 36 cm; polymer POP -4 tm ; and dye set Z. The software SeqScape v 3.0 (Thermo Fisher Scientific Inc., MA, USA) was used to perform data analysis.
6
Chloroplast and Nuclear DNA Polymorphism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymorphism was assessed using sequences of three chloroplast DNA (cpDNA) intergenic spacers, psbA-trnH, trnC-ycf6 and trnS-trnG [45 (link)], and the nrDNA ITS1 + 5.8S + ITS2 (primers 75 and 92, [46 ]). DNA was amplified by PCR following the same conditions described in Collevatti et al. [2 (link)] for T. impetiginosa. PCR products were sequenced on a GS 3500 Genetic Analyzer (Applied Biosystems, CA) using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), according to the manufacturer instructions. All fragments were sequenced in forward and reverse directions.
Sequences were analysed and edited using the software SeqScape v3.0 (Applied Biosystems, CA) and final alignments were obtained using the software ClustalΩ [47 (link)]. Polymorphisms at mononucleotide microsatellites in cpDNA were excluded due to ambiguous alignment and to higher mutation rates. Long indels were coded as one evolutionary event (one character) and each base pair were equally weighted before analyses. The sequences of the three chloroplast regions were concatenated for all analyses.
Sequences were analysed and edited using the software SeqScape v3.0 (Applied Biosystems, CA) and final alignments were obtained using the software ClustalΩ [47 (link)]. Polymorphisms at mononucleotide microsatellites in cpDNA were excluded due to ambiguous alignment and to higher mutation rates. Long indels were coded as one evolutionary event (one character) and each base pair were equally weighted before analyses. The sequences of the three chloroplast regions were concatenated for all analyses.
7
Identification of a Novel Cannabis Allele
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An off-ladder and off-bin peak was observed in 32 of the 36 Cannabis samples from Northeastern Brazil, very close to locus B01 CANN1. For these reasons, single PCR product from four homozygous samples that exhibit this peak close to locus B01 CANN1 was sequenced to check whether it could be considered a new, undescribed allele. A specific primer pair was designed using Primer 3 software from NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). PCR amplification and cycling sequencing were carried out on a VERITI 96-well Thermo Cycler (Thermo Fisher Scientific, Waltham, MA). BigDye Direct Cycle Sequencing Kit (Applied Biosystems) was used and followed the manufacturer's protocol. Samples were run on a 3130 Genetic Analyzer (Applied Biosystems) or a 3500 Genetic Analyzer (Applied Biosystems) under the following conditions: oven 60 °C; prerun 15 kV, 60 s; injection 1.2 kV, 23 s; run 15 kV, 1200 s; capillary length 36 cm; polymer POP-4TM; and dye set Z. Data analysis was performed on the SeqScape v 3.0 (Applied Biosystems).
Allele 10 of the locus B01 CANN1 sequences data has been submitted to the GeneBank databases under accession numbers MH520119, MH520120, and MH520121.
Allele 10 of the locus B01 CANN1 sequences data has been submitted to the GeneBank databases under accession numbers MH520119, MH520120, and MH520121.
8
ANGPTL6 Gene Exon Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted genomic DNA and performed PCR to amplify exons 2–6 of the ANGPTL6 gene followed by Sanger sequencing. Primer sequences can be provided upon request. We cleaned up the PCR product using Exo-Fast, before performing dye-terminator sequencing PCR with BigDye Terminator v3.1 (Thermo Fisher). The sequencing PCR product was cleaned using Sephadex (Sigma Aldrich) before being loaded onto the AB1 3730xl genetic analyzer (Applied Biosystems). We used SeqScape v.3.0 software (Applied Biosystems) for sequence analysis.
In accordance with the previous publication, we filtered out variants with a minor allele frequency (MAF) higher than 1% in the Genome Aggregation Database (gnomAD), v2.1.1.13 (link)
In accordance with the previous publication, we filtered out variants with a minor allele frequency (MAF) higher than 1% in the Genome Aggregation Database (gnomAD), v2.1.1.13 (link)
9
PCR Amplification and Sequencing of ORF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ORF was amplified using PCR primers Ce19_F (ATTTTGCAGATAAGTCATC) and Ce 778_R (AGAAGATAATGAAAACAGGAAG) [14 (link)]. PCR conditions were 95 °C for 2 min, followed by 36 cycles at 95 °C for 30 s, 51 °C for 30 s and 72 °C for 45 s, then a final cycle at 72 °C for 10 min. PCR fragments were directly sequenced using Ce19_F and Ce 778_R and BigDye® reagents (Life Technologies, Paisley, UK) as recommended by the manufacturer. Sequence data were analysed using Seqscape v3.0 software, Sequence Scanner v2.0 (Applied Biosystems) and MEGA7 version 7.0.26 [45 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!