Revertaid first strand kit

RNA from primary chondrocytes was extracted with Trizol and RNA was treated with DNase I (Invitrogen). Reverse transcription was performed using RevertAid First strand kit (Thermo). PCR was performed with Platinum Taq Polymerase. Coding sequence primers used were: IFT81 87 Fw: TCAATAAGGAGCCCTTTAGGAA; IFT81 87 Rv: AATCACCAAACCCTGACGAA; IFT81 1534 Fw: GAAAGGACGAACATTGGATGA; IFT81 1534 Rv: AAGACATTCTTCACGGAGTCTTC; Bact Fw: TCCCTGGAGAAGAGCTACGA; Bact Rv: AGGAAGGAAGGCTGGAAGAG.

RNA was extracted 48 h after transfection using Trizol (Invitrogen, Waltham, MA, USA, cat. number 15596018) as described in the manual (MAN0016385) and DNA digested with DNAase I (Invitrogen, Waltham, MA, USA, #18068015). The presence of the 28S and 18S was evaluated on 1% agarose gels. The RNA was quantified on a spectrophotometer, and a PCR was performed employing the GAPDH primers to ensure that no DNA was left. Then 1 μg of RNA per sample was used for retro-transcription using the RevertAid First Strand Kit (Thermo ScientificTM, Waltham, MA, USA, #K1691). cDNA was obtained and the qRT PCR was performed by using Thermo Maxima SYBR Green/ROX 1qPCR Master Mix (Thermo ScientificTM, Waltham, MA, USA, #K0251). The following primers were used: E6-18-F: 5′-GCG ACC CTA CAA GCT ACC TG-3′, E6-18-R: 5′-GTT GGA GTC GTT CCT GTC GT-3′; E7-18-F: 5′-AAC ATT TAC CAG CCC GAC GA-3′, E7-18-R: 5′-TCG TCT GCT GAG CTT TCT AC-3′; E6-16-F: 5′-ACT GCA ATG TTT CAG GAC CC-3′, E6-16-R: 5′-TCA GGA CAC AGT GGC TTT TG-3′; E7-16-F: 5′-CCC AGC TGT AAT CAT GCA TG-3′, E7-16-R: 5′-TGC CCA TTA ACA GGT CTT CC-3′; GAPDH-F: 5′-AAG GTC GGA GTC AAC GGA TTT-3′, GAPDH-R: 5′-CCA TGG GTG GAA TCA TAT TGG AA-3′. PCR cycles were as follows: 95 °C/10 min, 35 cycles: 95 °C/35 s; 60 °C/ 35 s; 72 °C/35 s. Data were processed with the Delta CT method.

To survey the presence of PrVI in both C. vitalba and different cultivars of cultivated Prunus species, leaves of the plants were collected. C. vitalba plants growing at different places in the vicinity of Budapest (Budapest, Gödöllő, Szada) showing different leaf chlorosis were sampled in 2018, 2020 and 2021. Total nucleic acid was extracted using the phenol–chloroform method. cDNA was prepared using the Maxima H minus kit (Thermo Fisher Scientific, Waltham, MA, USA). Sweet cherry and peach samples, growing in a cultivar collection at Érd, were also tested for the presence of PrVI. From these plants RNA was extracted with the CTAB method [21 (link)]. cDNA from these samples was prepared using the Revertaid First Strand kit (Thermo Fisher Scientific, Waltham, MA, USA), using random primers. RT-PCR was carried out using Q5 DNA polymerase (New England Biolabs, Ipswich, MA, USA) and previously published PrVI-CP-F/PrVI-CP-R primers [14 (link)].

Total RNA was extracted with Reagent kit (TIANDZ, China) according to the manufacturer's instructions. Quantificational real-time polymerase chain reaction for lncRNA-OBFC2A with specific primers from Sangon Biotech (Shanghai, People's Republic of China) was performed using Revert Aid First Strand Kit (Thermo Fisher Scientific, USA) and KAPA SYBR FAST Universal qPCR kit (KAPA, US) according to the manufacturer's protocol. β-actin was used as an endogenous control to normalize mRNA levels. The sequences of primers were as follows: lncRNA-OBFC2A: forward: 5′GTTGGTGTGCGGAGTGGTT3′; reverse: 5′GCAGAAAGCCGTTAGTCAGG3′; NOTCH1: forward: 5′CAATGAGTTC
CAGTGCGAGT3′; reverse: 5′GTAAGTGTTG GGTCCGTCCA3′; KLF15: forward: 5′TACACCAA AAGCAGCCACCT3′; reverse: 5′TCTTCTCGCACACA GGACAC3′; β-actin: forward: 5′TGAGACCTTCA ACACCCCAG3′; reverse: 5′GCCATCTCTTGCTC GAAGTC3’. Real-time reverse transcription-polymerize chain reaction was performed on Bio-Rad (CFX96™ optics module). Each sample was repeated three times. Data were analyzed by comparing cycle threshold values.

The same tissues used for RNA-seq were used for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. The RNA was treated with the DNase I enzyme (TURBO DNA-free™, Ambion^®). For cDNA synthesis, DNase-treated RNA was used with the RevertAid First Strand^® kit (Thermo Scientific^®, Lithuania). The real-time PCR were performed in a Thermal Cycler (iCycler IQ5; Bio-Rad, Hercules, CA, USA) with specific primers designed (Table 1). Each analysis was performed in triplicate with the Maximum SYBR^® Green/Fluorescein qPCR kit (Thermo Scientific^®) according to the manufacturer’s instructions. The reaction of each sample resulted in a final volume of 25 µL, constituting of 12.5 μL of SYBR Green/Fluorescein (2X), 0.3 μM of each oligonucleotide and 2000 ng of RNA. The thermal protocol was 95 °C for 30 s and 35 cycles of 64 °C for 1 min and 72 °C for 30 s. The data were analyzed with iQ5 optical system software v.2 (Bio-Rad). Finally, the method of 2^−ΔΔCT by Livak et al. [22 (link)], was used to calculate fold changes. The significance of the expression levels between the control group (β-actin) and the treatments (CA5A and FEM1B) were determined for analysis using the Mann–Whitney U-test and Kruskal–Wallis test. Statistical analyses were performed using Sigma Plot (SYSTAT, Chicago, IL, USA) and figures were plotted using Prism 5.0 (GraphPad Software Inc., San Diego, CA, USA).