T vector

HIB-1B cells were plated in 6-well plates at a density of 5 × 10⁵ cells/well and reached 90% confluence when they were ready for transfection the following day. Cells were transfected with 2.5 μg/well pLenti-Puro-sgSIK3-C (SC) or pLenti-Puro-sgNT plasmids by PEI reagent as previously described [34 ]. Six-hours after transfection, cells were replenished with Growth Medium. Twenty-four hours after transfection, 2 μg/ml puromycin were added to the medium for drug selection for 3 days. Cells were then supplemented with fresh Growth Medium, allowed to recover for 9 h, trypsinized and replated in 96-well plate at a density of 1.6 cell/100ul/well. Single-cell clones were passaged and cryo-stored in liquid nitrogen. The genomic DNA were extracted from each clone with PureLink Genomic DNA Mini Kit (Invitrogen) and PCR amplified with the forward primer TCCCCTTCAGCTCTGTTCAG (mSik3-sgC-F1) and reverse primer AAGTGAAGTCTGGAGTGGGG (mSik3-sgC-R1). The PCR products were subcloned to T-vector (Promega) and sequenced. Two clones with frame-shifted mutations in Sik3 gene were validated for the efficient knockout of SIK3 protein and considered as Sik3^−/− brown adipocytes (SC19 and SC13). A pool of twelve single clones derived from the mock transfection of pLenti-Puro-sgNT plasmid were used as non-targeting control (NTC).

DIG-labeled RNA probes targeting exons 2 and 4 were made using an in vitro transcription kit. The primer pairs used to generate exon 2- and 4-targeted probes are listed in Table S3. RT-PCR fragments obtained from previous primers were sub-cloned into a T-vector (Promega) and used as templates for in vitro transcription. Whole-mount in situ hybridization was performed according to the protocol published previously32 (link).

Bacterial strains and plasmids used in this study are listed in Table 1. The ghost strain was constructed as described earlier [14 (link)]. Briefly, polymerase chain reaction amplification of the ghost cassette was performed using pHCE GAPDH ghost 37SDM as a template and the primers ghost-F-XbaI (5'-TCTAGAGACCAGAACACCTTGCCGATC-3') and ghost-R-XbaI (5'-TCTAGAACATTACATCACTCCTTCCG-3') [12 (link)]. The amplified DNA segment was cloned onto the T-vector (Promega, Madison, WI, USA) and was designated pJHL99. The plasmid pJHL101, an antibiotic gene free plasmid containing the ghost cassette, was constructed by enzymatic fusion of pJHL99 and asd⁺ containing pYA3342 plasmids [28 (link)]. The safety enhanced SG ghost vaccine was then constructed by transformation of the plasmid pJHL101 into lon, ΔcpxR, and asd deleted JOL967 cells [4 (link)] by electroporation and resultant SG transformants were selected on Luria-Bertani (LB) agar plates without diaminopimelic acid (DAP; Sigma, St. Louis, MO, USA). The SG ghost cells were harvested at 18 hours after the lysis induction with temperature upshift from 37℃ to 42℃, washed three times with sterile phosphate buffered saline (PBS), suspended in PBS, and stored at -20℃. All strains were preserved in LB broth with 20% glycerol and stored at -80℃ until use.

Human STAT3 cDNA plasmid was purchased from Open Biosystems (clone ID 3347434). The K685R mutation was generated following the Stratagene Site-Directed Mutagenesis protocol. The mutant primer sequence is 5′-CTC TGG CCG ACA ATA CCT TCC GAA TGC CTC CTC-3′. The wild-type and mutant full-length STAT3 sequences were amplified using a forward primer with a Bam¹H cutting site (5′-TTG GAT CCG CCA CCA TGG CCC AAT GGA ATC AGC TAC-3′) and a reverse primer with an Xma1 cutting site (5′-CCG GCC CGG GTC ACA TGG GGG AGG TAG CGC-3′). PCR product then was cloned, first into a T-vector (Promega A1360) and finally into a pHR-CMV-MCS-IRES-gfp-delta B vector using Bam¹H and Xma1. Human wild-type and K310R mutant p65 plasmids were also generated. PCR product was obtained with the following primers: 5′-CTA GAC TAG TTT AGG TGC TGA TCT GAC TCA-3′ (sense) and 5′-TAG ATA TCT TAG GAG CTG ATC TGA CTC AGC-3′ (antisense). The strategy of cloning into pHR-CMV-MCS-IRES-gfp-delta B vector was the same as that of STAT3, except endonucleases were used for Bam¹H (5′ end) and Sma1 (3′ end).

Pygmy squid Pax-6 cDNAs were obtained by 5′- and 3′-RACE PCR using a SMARTer RACE kit (Takara) and then sub-cloned into a T-vector (Promega). RT-PCRs were performed using squid embryonic and adult RNAs to confirm the alternative splicing forms. The RNAs were reverse transcribed into cDNA using PrimeScript® RT Reagent (Takara) and amplified using Advantage2 PCR (Takara) kits. The primers used in the cloning steps are listed in Table S1. The nucleotide sequences obtained in this study are available under the following accession numbers: [DDBJ: AB716343-AB716348].