The largest database of trusted experimental protocols

27 protocols using cpg b

1

Immunoblotting for Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510) (1:3000), mouse anti-GFP (Sungene Biotech, KM8009) (1:2000), mouse anti-FLAG (KM8002) (1:2000), mouse anti-β-Actin (KM9001) (1:2000), mouse anti-HA (COVANCE, MMS-101R) (1:2000), anti-pIκBα (9246 L)(1:1000), anti-Ubiquitin (sc-8017) (1:500), anti-Ubiquitin, K48 specific (Merck, 05-1307), anti-IRF3 (sc-9082) (1:1000), anti-IκBα (sc-371) (1:1000), anti-p-IRF3 (4947 S) (1:1000), anti-TBK1 (GR96328-11) (1:2000) and anti-cGAS (sc-515777) (1:1000)were purchased from the indicated manufactures. LPS (Sigma, L2630) and CpG-B (Invivogen, tlr-1826) were purchased from the indicated manufactures. Poly(I:C), ISD45, DNA90, and HSV120 were previously described.35 (link) ISD45: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; DNA90: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; HSV120: 5′-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3′.
+ Open protocol
+ Expand
2

Immune Stimulant Compounds Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
LTA-SA, FSL-1, FLA-ST, poly(I:C), LPS, R837, R848, CpG-A (ODN 2216) and CpG-B (ODN 2006) were purchased from Invivogen.
+ Open protocol
+ Expand
3

Dendritic Cell Vaccination with TLR Agonists

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bone marrow-derived CD11c+ DCs were generated after 5 days of culture with GM-CSF and matured with LPS (50ng/ml) overnight as described previously (11 (link), 30 (link)). Matured DCs were pulsed with GP33-41 peptide (200ng/ml) for 2h, washed with PBS and 1×106 DC-33 cells were injected intravenously (i.v.). Simultaneously, DC immunized mice were injected intraperitoneally (i.p.) with either PBS or one of the following TLR ligands: PAM3CSK4 (50μg), poly I:C (50μg), LPS (20μg), MPLA (30μg), Flagellin(20μg), LTA(20μg), R848 (20μg), CpG-A (50μg) or CpG-B (50μg). The dose for each adjuvant was primarily determined by either previous publications (14 (link), 15 , 31 (link)-34 (link)) and/or manufacture recommendations. Additional titrations were done in some cases to ensure comparable CD8 T cell responses at the effector phase as shown in Supplementary Figure 1 and no perceivable side effects. LPS was purchased from Sigma-Aldrich, St. Louis, MO; CpG-A and CpG-B were synthesized at Yale University Keck Facility; and the rest were all purchased from InvivoGen, San Diego, CA.
+ Open protocol
+ Expand
4

Activation and Profiling of PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fresh human or NHP PBMCs were labeled with 0.25 µM CellTrace Violet (Invitrogen, C34557) at a cell concentration of 1 million/mL for 20 min at 37 °C. Labeled PBMCs were then incubated with testing antibodies, 1 µg/ml CpG-B (Invivogen, tlrl-2006) or left untreated in complete media (RPMI1640, 10% FBS, 1% L-glutamine, 1% penicillin/streptomycin) and were cultured for 5 days. Some samples were cultured for 5 days under 10 ng/mL IL-4 and 50 ng/mL IL-21 supplemented condition as described earlier [32 (link)]. After culture, cells were washed with PBS and stained with LIVE/DEAD prior to FcR Blocking as described above. Samples were then surface stained with a panel of fluorescently labeled antibodies (Table S1). After staining and washing, PBMCs were resuspended in 1% PFA and acquired on an LSRFortessa flow cytometer.
+ Open protocol
+ Expand
5

PBMC Activation and IgG Production

Check if the same lab product or an alternative is used in the 5 most similar protocols
Peripheral blood mononuclear cells (PBMCs) were isolated from heparinized blood of healthy adult donors using standard ficoll density gradient separation. Cells were frozen and stored in liquid nitrogen until use. PBMCs (2x105 cells/well) were cultured in RPMI with 10% heat-inactivated fetal bovine serum and 10 μg/ml gentamicin in 96 well flat-bottomed plates with CpG class B (Integrated DNA Technologies) (referred to here as CpG-B (PS)) with or without TFAM at the indicated concentrations. For blocking experiments, we used colchicine (150 ng/ml; Sigma, St. Louis, MO), an inhibitor of microtubule-mediated uptake, and ODN TTAGGG (“iODN”; 10:1 ratio of iODN to CpG-B (PS), Invivogen, San Diego, CA), an inhibitory oligonucleotide and a TLR9 antagonist. After 7 days, culture supernatants were tested for IgG antibody production by enzyme-linked immunosorbent assay (ELISA) as previously described [43 (link)]. The Colorado Multiple Institutional Review Board (COMIRB) specifically approved this study and the use of all samples in these studies (#050993). Participants provided their written informed consent to participate in this study.
+ Open protocol
+ Expand
6

IL-6 Expression in CpG-B and CD40L Stimulated PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
PBMCs were cultured at a concentration of 2×106 cells/ml in RPMI-1640 containing L-glutamine, 10% FCS and antibiotics in medium only or stimulated with 10 μg/ml CpG-B (InvivoGen, California, USA) and 1 μg/ml CD40L (InvivoGen) for 48 h. For the last 5 hours of the culture, an additional stimulation with 50 ng/ml PMA and 1 μg/ml Inomycin (Sigma-Aldrich, MO, USA) in the presence of Golgistop used at 1:1000 dilution (BD) was performed. Cells were first stained for cell surface markers PerCp anti-CD19, FITC anti-CD10 and V450 anti-CD27 in addition to LIVE/DEAD staining. In next step cells were fixed and permeabilized using BD Cytofix/Cytoperm kit and stained with PE anti-IL-6 (MQ2-6A3) and matching isotype control, both from (BD). Cells were washed and fixed in 1% formaldehyde before the analysis were conducted using a Cyan flow cytometer. Collected data were analysed using FlowJo, version 9.4.11 (Tree star).
+ Open protocol
+ Expand
7

Induction of Type I Interferon by TLR Agonists

Check if the same lab product or an alternative is used in the 5 most similar protocols
pDC-Gen2.2 cells were cultured at 1–2 10^6 cells/ml in complete RPMI 1640 on the MS-5 feeder cells. Before the experiment, the non-adherent fraction of the culture was harvested, pelleted at 1500 rpm and re-suspended in a fresh medium. 50,000 cells were plated in 96-well round bottom plates and stimulated with 0.25μM CpGA (Invivogen, tlrl-2216), 0.25μM CpGB (Invivogen, tlrl-2006), 3.75μg/ml R848 (Invivogen, tlrl-r848), 0.5μg/ml LPS (Invivogen, tlrl-b5lps) or were left unstimulated (Mock) in total volume of 150μl. The stimulation assay was performed with and without 5μM RBV (1221 ng/ml) (Sigma, R9644). At time points (indicated in figures), the culture supernatants were analyzed for IFNα by ELISA and cells were harvested for RNA isolation and qRT-PCR analysis of gene expression. Where total PBMCs were used, 50,000 cells were stimulated with 0.25μM CpGA +/- RBV and analyzed as above.
+ Open protocol
+ Expand
8

Inducing and Analyzing Apoptotic Thymocyte Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate apoptotic cells, thymocytes were cultured with 1 uM Dexamethasone (Sigma) for 4 h at 37°C. Staining with 7AAD and Annexin V (BD Biosciences) determined that this treatment typically resulted in 45% of Annexin V+ apoptotic thymocytes and in 1% of 7AAD+ Annexin V- necrotic thymocytes. Marginal zone and follicular B cells were sorted from purified splenic CD43 B cells as IgM+CD21+CD23 for MZ B cells and IgM+CD21CD23+ for FO B cells, using a FACS Aria-II cell sorter (BD Biosciences). Post-sorting purity of either subset was greater than 90%. The sorted MZ or FO B cells were co-cultured at a 1∶7 ratio with apoptotic thymocytes and 1 ug/ml CpG-B (Invivogen) for 3 d at 37°C. Cytokines were quantified from extracted RNA and culture supernatant by qPCR and ELISA, respectively.
+ Open protocol
+ Expand
9

In vitro PBMC Stimulation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
CpG-A (ODN 2,216), CpG-B (ODN 2006), CL413 (Adilipolin), CL267 and R848 were obtained from InvivoGen (San Diego, USA) for use in in vitro PBMC stimulation assays, and GS-9620 was a gift from Gilead Sciences. All of them were used at concentration recommended by manufacturer for optimal in vitro stimulation. Recombinant IFN-α-2a and IFN-λ3 were obtained from PBL. Anti-Human Interferon Lambda Receptor 1 (IFNLR), clone MMHLR-1, neutralizing (MAb) was from PBL; Anti-IFN-α/β Receptor Chain 2 Antibody, clone MMHAR-2, MAB1155 was from EMD Millipore.
+ Open protocol
+ Expand
10

Isolation and Characterization of Murine pDCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bone marrow (BM) cells removed from tibiae, femurs and hips of 8- to 14-week-old C57BL/6J mice were incubated in low endotoxin RPMI-1640 medium (Fisher Scientific, Illkirch, France) supplemented with 10% (vol/vol) FCS and 1% antibiotics (penicillin and streptomycin) for 18 h with 1 μg/ml of the oligodeoxynucleotide CpG 1668 (CpG-B) (Eurogentec, Angers, France) or with the respective agonists of TLR1-9, supplied in a commercial kit (InvivoGen, Toulouse, France), including: Pam3CSK4 (0.5 μg/ml), FSLI (1 μg/ml), HKLM (2 × 106 cells/ml), Poly I:C (HMW) (5 μg/ml), Poly I:C (LMW) (5 μg/ml), LPS-EK standard (1 μg/ml), FLA-ST standard (1 μg/ml), ssRNA40/LyoVec (2 μg/ml) as well as CpG 1826 (CpG-B) (1 μg/ml). c-kit+ BM cells were sorted by immuno-magnetic separation using a RoboSep automaton (StemCell Technologies, Grenoble, France). Sorted cells were further stained with appropriate fluorochrome-conjugated mAbs against Sca-1, B220 (BD Biosciences, Le Pont de Claix, France), PDCA-1 (eBioscience, Paris, France or BioLegend, London, UK) and electronically sorted as a c-kit+Sca-1+B220+PDCA-1+ cell subset using a FACS-Aria IIIu (BD Biosciences).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!