Gene frame

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany

The Gene Frame is a laboratory equipment product designed for the secure containment and framing of nucleic acid samples. It provides a secure and protected environment for the storage and handling of genetic materials during laboratory procedures.

Automatically generated - may contain errors

Lab products found in correlation

Nis elements software, by Nikon (5 mentions) Spinning disk ultraview ers, by Olympus (3 mentions) Eclipse ti inverted microscope, by Nikon (3 mentions) Permanox slide, by Merck Group (3 mentions) Volocity, by PerkinElmer (3 mentions) Axio observer, by Zeiss (3 mentions) Coolsnap hq2 firewire ccd camera, by Nikon (2 mentions) Eclipse ti e, by Nikon (2 mentions) Glass coverslip, by Thermo Fisher Scientific (2 mentions) Ti e microscope, by Nikon (2 mentions) Plan apochromat 100x oil ph3, by Zeiss (2 mentions) Eclipse 90i, by Nikon (2 mentions) Cycloheximide (chx), by Thermo Fisher Scientific (2 mentions) Cycloheximide (chx), by Merck Group (2 mentions) Lsm 880, by Zeiss (2 mentions) Labview interface, by National Instruments (1 mentions) Orca flash 4.0 cmos camera, by Hamamatsu Photonics (1 mentions) Softworx, by Cytiva (1 mentions) Dv elite microscope, by GE Healthcare (1 mentions) Eclipse ti microscope, by Nikon (1 mentions)

67 protocols using gene frame

UV-Vis Absorbance Spectroscopy Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The absorbance
spectra of the samples before and after UV irradiation were recorded
using a UV–vis spectrophotometer of type Evolution 201 (ThermoScientific,
Germany) on a sample with a thickness of 250 μm. Samples were
placed on a glass slide and covered with a Gene Frame, Thermo Scientific,
which was adhered to a glass slide to form a thin film between the
glass and Gene Frame. An empty Gene Frame adhered to a clean glass
slide was used as a reference sample.

Nekoonam N., Vera G., Goralczyk A., Mayoussi F., Zhu P., Böcherer D., Shakeel A, & Helmer D. (2023). Controllable Wetting Transitions on Photoswitchable Physical Gels. ACS Applied Materials & Interfaces, 15(22), 27234-27242.

+ Open protocol

+ Expand

Real-time Tracking of Neuronal Projections in Xenopus

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Targeted electroporation was carried out as previously described (Falk et al., 2007 (link)). At stage 28, Xenopus embryos were anesthetized with 40 mg/100 mL MS222 in 1X MBS, followed by injection of pCS2+mGFP cDNA (2 μg/μL) into the ventricle between the retina and the brain. Four electric pulses of 50 ms duration were delivered at 18V and 1000 ms intervals. The embryos were then recovered and raised in 0.1X MBS. At stage 35/36 or 37/38, embryos were anesthetized with 40 mg/100 mL MS222 in 1X MBS. On the contralateral hemisphere of the electroporated eye, the lateral surface of the optic tract was exposed by carefully removing the overlying eye and skin (Chien et al., 1993 (link)). The embryos were then recovered in 10 mg/100 mL MS222 in 1X MBS and mounted into an oxygen-permeable chamber consist of a Permanox slide (Sigma-Aldrich) and Gene Frame (Thermo Scientific). Time-lapse imaging at 30 s per frame was performed at 60X with Perkin Elmer Spinning Disk UltraVIEW ERS, Olympus IX81 inverted spinning disk confocal microscope. Z stack intervals of 1.5 μm were used for acquiring images with Volocity (Improvision).

Cioni J.M., Wong H.H., Bressan D., Kodama L., Harris W.A, & Holt C.E. (2018). Axon-Axon Interactions Regulate Topographic Optic Tract Sorting via CYFIP2-Dependent WAVE Complex Function. Neuron, 97(5), 1078-1093.e6.

+ Open protocol

+ Expand

Constructing Sealed Agarose Chambers for Cell Transformation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two types of coverslips were used to construct sample chambers. The first coverslip (24 х 24 mm, Menzel-Gläser) was attached to a double-sided adhesive frame (1.5 х 1.6 cm Gene Frame, Thermo Scientific). To form smooth agarose surface inside the frame, 70 μl of 1.5% agarose (Helicon) diluted in 0.25X LB medium (Amresco) with the addition of 100 μg/ml ampicillin was placed in the center of the coverslip attached to the frame and pressed with the second similar coverslip. After solidification of agarose the second coverslip was removed. To provide oxygen supply for the cells in a sealed chamber, 1.5 х 0.5 cm strips of agarose gel from each of two sides of the gel slab were removed. Transformation mixture (1 μl) was placed on the resulting agarose surface (1.5 х 0.6 mm). When transformation mixture was completely absorbed, the chamber was sealed using a longer coverslip (24 х 60 mm, Menzel-Gläser). The sealed chamber was fixed in custom-build holder and mounted in the microscope.

Morozova N., Sabantsev A., Bogdanova E., Fedorova Y., Maikova A., Vedyaykin A., Rodic A., Djordjevic M., Khodorkovskii M, & Severinov K. (2015). Temporal dynamics of methyltransferase and restriction endonuclease accumulation in individual cells after introducing a restriction-modification system. Nucleic Acids Research, 44(2), 790-800.

+ Open protocol

+ Expand

Imaging Myxococcus-E. coli Predation Dynamics

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Prey invasion was imaged by microscopy using the Bacto-Hubble system the specific details of the Method are described elsewhere (Panigrahi, 2020 (link)). Briefly, cell suspensions concentrated to OD₆₀₀=5 were spotted at 1 mm distance onto CF 1.5% agar pads and a Gene Frame (Thermo Fisher Scientific) was used to sandwich the pad between the slide and the coverslip and limit evaporation of the sample. Slides were incubated at 32°C for 6 hr before imaging, allowing Myxococcus and E. coli to form microcolonies. Time-lapse of the predation process was taken at ×40 or ×100 magnification. Movies were taken at the invasion front where Myxococcus cells enter the E. coli colony. To facilitate tracking, M. xanthus cells were labeled with fluorescence (Ducret et al., 2013 (link)). Fluorescence images were acquired by microscopy every 30 s for up to 10 hr, at room temperature (see below for experimental details of time lapse acquisitions ).

Seef S., Herrou J., de Boissier P., My L., Brasseur G., Robert D., Jain R., Mercier R., Cascales E., Habermann B.H, & Mignot T. (2021). A Tad-like apparatus is required for contact-dependent prey killing in predatory social bacteria. eLife, 10, e72409.

+ Open protocol

+ Expand

Agarose-based Microbial Growth Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A sterile 55 × 25 × 2.4 mm Perspex slide with a 33 mm × 10 mm hole was lightly fixed to a standard glass microscope slide using petroleum jelly, creating a 792 µl well. Molten 3% M9 agarose was pipetted into the cavity and a microscope coverslip used to flatten the surface. Once the agarose had solidified, the coverslip was carefully removed, revealing an agarose slab. One microlitre of diluted mixed culture was pipetted three quarters up the length of the agarose, and the slide held at an angle, so liquid culture would run the length of the surface.
After the liquid culture had been fully absorbed, a clean coverslip was carefully placed over the agarose and sealed to the Perspex frame using VALAP [57 (link)]; the Perspex frame was then also sealed to the microscope slide to ensure air tightness.
For cell lag-time experiments, the Perspex slide was replaced with a Gene Frame (Thermo Scientific), a disposable, double-sided adhesive plastic frame with volume of 125 µl [58 (link)]. The cell mixing ratio was 1 : 1, and cultures were diluted to an appropriate optical density to maximize the number of cells in a single field of view.

Lloyd D.P, & Allen R.J. (2015). Competition for space during bacterial colonization of a surface. Journal of the Royal Society Interface, 12(110), 20150608.

+ Open protocol

+ Expand

Time-lapse imaging of bacterial microcolonies

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Strains were inoculated in lysogeny broth (LB) from glycerol stocks and shaken overnight at 37 °C. The next day, cultures were diluted and seeded on a gel pad (1% agarose in LB). The preparation was sealed on a glass coverslip with double-sided tape (Gene Frame, Fischer Scientific). A duct was previously cut through the center of the pad to allow for oxygen diffusion into the gel. Temperature was maintained at 34 or 28 °C using a custom-made temperature controller^{68 (link)}. Bacteria were imaged on a custom microscope using a 100×/NA 1.4 objective lens (Apo-ph3, Olympus) and an Orca-Flash4.0 CMOS camera (Hamamatsu). Image acquisition and microscope control were actuated with a LabView interface (National Instruments). Segmentation^{69 (link)} and cell lineage were computed using a MatLab code developed in the Elowitz lab (Caltech)^{70 (link)}. For microcolony analysis, cultures were diluted 10⁴ times in order to obtain a single bacterium in the field of view. Typically, we monitored four different locations; images were taken every 3 min in correlation mode^{56 (link)}.

Duvernoy M.C., Mora T., Ardré M., Croquette V., Bensimon D., Quilliet C., Ghigo J.M., Balland M., Beloin C., Lecuyer S, & Desprat N. (2018). Asymmetric adhesion of rod-shaped bacteria controls microcolony morphogenesis. Nature Communications, 9, 1120.

+ Open protocol

+ Expand

In Vivo Imaging of Neuronal Activity

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Embryos were lightly anesthetized with 0.4 mg/ml MS222 in 1xMBS. The lateral surface of the brain contralateral to the electroporated eye was exposed by carefully removing the overlying epidermis and the contralateral eye. Embryos were mounted in an oxygenated chamber created with Permanox slides (Sigma-Aldrich) and Gene Frame (ThermoFisher), and bathed in 1xMBS with 0.1 mg/ml MS222, for visualization with fluorescence microscopy (Roque et al., 2016 (link); Wong et al., 2017 (link)). Imaging was performed using the 60X UPLSAPO objective (NA 1.3) with a PerkinElmer Spinning Disk UltraVIEW ERS, Olympus IX81 inverted spinning disk confocal microscope. Z-stack intervals of 1.5 μm were employed for acquiring images with Volocity (PerkinElmer).

Leung K.M., Lu B., Wong H.H., Lin J.Q., Turner-Bridger B, & Holt C.E. (2018). Cue-Polarized Transport of β-actin mRNA Depends on 3′UTR and Microtubules in Live Growth Cones. Frontiers in Cellular Neuroscience, 12, 300.

+ Open protocol

+ Expand

Live-cell imaging of bacterial stress response

Check if the same lab product or an alternative is used in the 5 most similar protocols

Strains were grown overnight in TSB medium at 37°C, then diluted 100 times in fresh TSB and grown until OD = 0.1. Cells were washed once with fresh TSB and spotted onto TSB–acrylamide (10%) pads previously incubated for 2 h in TSB medium supplemented, when appropriate, with 0.04 µg ml⁻¹ mitomycin C (MMC) or 200 ng ml⁻¹ anhydrotetracycline (AHT). Pads were placed into a Gene frame (Thermo Fisher Scientific) and sealed with a cover glass. Phase‐contrast images were acquired on a DV Elite microscope (GE healthcare) equipped with a sCMOS (PCO) camera and a 100x oil immersion objective. Images were acquired with 200 ms exposure time every 4 min for at least 6 h at 37°C using Softworx (Applied Precision) software. Images were analyzed using Fiji (http://fiji.sc).

Bojer M.S., Wacnik K., Kjelgaard P., Gallay C., Bottomley A.L., Cohn M.T., Lindahl G., Frees D., Veening J., Foster S.J, & Ingmer H. (2019). SosA inhibits cell division in Staphylococcus aureus in response to DNA damage. Molecular Microbiology, 112(4), 1116-1130.

+ Open protocol

+ Expand

In-Situ Detection of SFTS Virus

Check if the same lab product or an alternative is used in the 5 most similar protocols

SFTS viral RNA was detected with ISH, the AT tailing method, for high-sensitivity signal detection [6 (link)]. Paraffin sections of the infected spleen were heated using pressure pan cooker with 10 mM citrate buffer, pH 6.0, for 10 min, followed by digestion with 0.1 μg/mL proteinase K for 15 min at 37°C. The sections were hybridized overnight at 50°C with 0.01 pmol/mL AT-tailed oligonucleotide antisense cocktail probes for the L, M and S segments of viral RNA: 5'-CACTACTAGTGTGACCACTCTTGAGTCTGG CCACTCAGAC(ATx10)-3' for the L segment, 5'-CACC ACCACCTGCATAACAGAGGGTAGTGAAGTGAAGCCA(ATx10)-3' for the M segment and 5'-GTGCTTATCTGA ATAGGCCTTGAACCAGGCGTGGAACTCC(ATx10)-3' for the S segment. After hybridization, the sections were rinsed in 1× saline sodium citrate (SSC) and 0.1× SSC for 10 min at 55°C, respectively. Gene Frame (Thermo Fisher Scientific, Yokohama, Japan) was attached to each slide for exposure to the AT tailing mixture consisting nucleotide, biotin-16-dUTP and Gene Taq DNA polymerase for 10 min at 60°C. The GenPoint system (Dako, Carpinteria, CA, USA) was employed for signal amplification. The reaction products were visualized in the DAB solution. Pre-embedding electron microscopy was carried out, as previously described.

Matsui T., Onouchi T., Shiogama K., Mizutani Y., Inada K.I., Yu F., Hayasaka D., Morita K., Ogawa H., Mahara F, & Tsutsumi Y. (2015). Coated Glass Slides TACAS Are Applicable to Heat-Assisted Immunostaining and In Situ Hybridization at the Electron Microscopy Level. Acta Histochemica et Cytochemica, 48(5), 153-157.

+ Open protocol

+ Expand

Agarose Microhole Cell Culture Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Agarose microholes were created by pouring molten 6% agarose onto a silicon micropillar array (Fig. S4). Patterned agarose was transferred into a Geneframe (Thermo Scientific AB-0577) mounted on a glass slide. The regions either side of the microholes were cut away, leaving a thin strip of agarose in the center of the Geneframe, to ensure sufficient oxygen. Cells at OD₆₀₀~0.4 were concentrated 100× by centrifugation. 4 μL of sample was then loaded onto the agarose pad and a cover slip was placed on top.

Bisson Filho A.W., Hsu Y.P., Squyres G.R., Kuru E., Wu F., Jukes C., Sun Y., Dekker C., Holden S., VanNieuwenhze M.S., Brun Y.V, & Garner E.C. (2017). Treadmilling by FtsZ Filaments Drives Peptidoglycan Synthesis and Bacterial Cell Division. Science (New York, N.Y.), 355(6326), 739-743.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!