Amicon ultra ym 3 columns

Manufactured by Merck Group

Sourced in Germany

The Amicon Ultra YM-3 columns are a type of laboratory equipment used for the filtration and concentration of sample solutions. These columns are designed to separate molecules or particles based on their molecular weight using a semi-permeable membrane. The core function of the Amicon Ultra YM-3 columns is to allow the passage of molecules below 3 kDa while retaining larger molecules or particles.

Automatically generated - may contain errors

Lab products found in correlation

Plasma serum circulating and exosomal rna purification mini kit slurry format, by Norgen Biotek (1 mentions) Nsolver software v3, by NanoString (1 mentions) Mirneasy serum plasma kit, by Qiagen (1 mentions)

2 protocols using amicon ultra ym 3 columns

Plasma RNA Purification and Normalization

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasma aliquots were thawed on ice and centrifuged at 800 × g for 10 min at 4 °C to minimise cellular and platelet RNA contamination^{27 (link)}. The upper 750 μl was removed for processing and the remaining plasma was discarded. RNA was extracted using the ‘Plasma/Serum Circulating and Exosomal RNA Purification Mini Kit (Slurry-Format)’ (Norgen-Biotek, Ontario, Canada). A spike-in of 5000 attomoles of synthetic cel-254 (sequence:UGCAAAUCUUUCGCGACUGUAGG, Integrated DNA Technologies BVBA, Leuven, Belgium) was added following the addition of lysis and denaturing buffers to allow downstream normalisation of any technical variation to the extraction process. Eluted RNA was further purified and concentrated using Amicon Ultra YM-3 columns (Millipore, Darmstadt, Germany) to a final volume of 25 μl.

Cook J., Bennett P.R., Kim S.H., Teoh T.G., Sykes L., Kindinger L.M., Garrett A., Binkhamis R., MacIntyre D.A, & Terzidou V. (2019). First Trimester Circulating MicroRNA Biomarkers Predictive of Subsequent Preterm Delivery and Cervical Shortening. Scientific Reports, 9, 5861.

+ Open protocol

+ Expand

Profiling Serum miRNA by High-Content Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human serum was isolated by centrifugation (2200g for 10 minutes at room temperature) from whole blood and snapfrozen. RNA was isolated from human and animal serum samples (200 μL) with the use of the miRNeasy Serum/Plasma Kit (Qiagen) according to the manufacturer’s instructions. Eluted RNA from serum samples was further purified and concentrated with the use of Amicon Ultra YM-3 columns (3000 kDa MWCO; Millipore).
For high-content miRNA analysis, RNAs after hybridization reactions were processed with the use of the nCounter Prep Station and nCounter Digital Analyzer. miRNA levels (n = 800) were analyzed with the use of the nSolver software v3.0 (Nanostring Technologies, Seattle, WA, USA). Normalization was performed with the use of all miRNAs (n = 110) with coefficients of variation <70%.^{14 (link)}Additional information is available in the Supplementary Methods.

Monaghan T.M., Seekatz A.M., Markham N.O., Yau T.O., Hatziapostolou M., Jilani T., Christodoulou N., Roach B., Birli E., Pomenya O., Louie T., Lacy D.B., Kim P., Lee C., Kao D, & Polytarchou C. (2021). Fecal Microbiota Transplantation for Recurrent Clostridioides difficile Infection Associates With Functional Alterations in Circulating microRNAs. Gastroenterology, 161(1), 255-270.e4.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!