Codon optimized FLAG HPV-31 E2 (DeSmet et al., 2016 (link)) and the ori-luciferase plasmids for the PV transient replication assay (Fradet-Turcotte et al., 2010 (link)) were used as previously reported (DeSmet et al., 2016 (link)). FGFR-1, 2, and 4 constructs were provided by L. Thompson (UC Irvine). A Myc tag was added to the C terminus of FGFRs by PCR amplification using the following Primers Bam-FGFR1-F: GATCGGATCCATGTGGAGCT, FGFR1-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGCGGCGTTT, Bam-FGFR2-F: GATCGGATCCATGGTCAGCT, FGFR2-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCTGTTTTAACACTG, Bam-FGFR3-F: GATCGGATCCATGGGCGCCCCT, FGFR3-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCCGTCCGCGA, Kpn-FGFR4-F: GATCGGTACCATGCGGCTGC, FGFR4-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCTGTCTGCAC, and inserted into pcDNA3. The following antibodies were used: mouse anti-FLAG M2, phospho-Tyrosine specific PY-99 (Santa Cruz) and PY-100 (Cell Signaling), rabbit anti-MYC (Cell Signaling), anti-FGFR1 (Abcam), anti-FGFR2 (Santa Cruz), and anti-FGFR4 (Santa Cruz). BPV-1 E2 was identified with B201, a mouse monoclonal antibody with an epitope between amino acids (aa) 160–220 (Breiding et al., 1996 (link)). Mouse-anti HPV-16-E2 (TVG-261) and HPV-16 E2 sheep-antiserum (Siddiqa et al., 2015 (link)) were used to identify HPV E2 proteins.
Mouse anti flag m2
Manufactured by Santa Cruz Biotechnology
The Mouse anti-FLAG M2 is an antibody that recognizes the FLAG epitope tag. It is commonly used for the detection and purification of FLAG-tagged proteins expressed in various cell types.
Automatically generated - may contain errors
Lab products found in correlation
Rabbit anti myc, by Cell Signaling Technology (1 mentions)
Anti fgfr4, by Santa Cruz Biotechnology (1 mentions)
Py100, by Cell Signaling Technology (1 mentions)
Anti fgfr1, by Abcam (1 mentions)
Anti fgfr2, by Santa Cruz Biotechnology (1 mentions)
Mouse anti ha, by Merck Group (1 mentions)
Mouse anti ki 67, by Santa Cruz Biotechnology (1 mentions)
Mouse anti ubiquitin, by Santa Cruz Biotechnology (1 mentions)
2 protocols using mouse anti flag m2
1
Codon-Optimized HPV-31 E2 and PV Replication Assay
2
Western Blot Analysis of Signaling Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues and cells were lysed with 2× SDS lysis buffer. Proteins were separated by 10% SDS-PAGE, transferred to nitrocellulose (NC) membranes, incubated with primary and secondary antibodies. The following primary antibodies were purchased: mouse anti-human FBXO2 (1:500, cat. no. sc-398111, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), mouse anti-ubiquitin (1:1000, cat. no. sc-166553, Santa Cruz Biotechnology, Inc.), mouse anti-IL-6Rα (1:500, cat. no. sc-373708, Santa Cruz Biotechnology, Inc.), mouse anti-gp130 (IL6ST) (1:500, cat. no. sc-376280, Santa Cruz Biotechnology, Inc.), mouse anti-Ki-67 (1:500, cat. no. sc-23900, Santa Cruz Biotechnology, Inc.), mouse anti-Flag M2 (1:5000, cat. no. F1804, Sigma-Aldrich, USA), mouse anti-HA (1:5000, cat. no. H9658, Sigma-Aldrich, USA), rabbit anti-human Phospho-Stat3 (Tyr705) (D3A7) (1:1000, cat. no. 9145S, Cell Signaling Technology, USA), mouse anti-human Stat3 (124H6) (1:1000, cat. no. 9139, Cell Signaling Technology, USA), mouse anti-human actin (1:10,000, cat. no. sc-8432, Santa Cruz Biotechnology, Inc.).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!