C57BL/6J and BALB/c mice at 8 weeks of age were purchased from SLAC Laboratory Animal Co. Ltd. (Shanghai, China). The CC10-CreERT2 mouse strain with genetic background of C57BL/6J was purchased from Model Animal Research Center of Nanjing University (Nanjing, China). The conditional caRhoA (caRhoA+/− ) knock-in mouse strain with genetic background of C57BL/6J was generated by Cyagen Biosciences (Santa Clara, CA) as described previously13 (link), and the conditional Rock2K1007R/+ knock-in founders with genetic background of C57BL/6 J were generated by CRISPR/Cas9 at Cyagen Biosciences as described previously49 (link). All animals were housed in a room maintained at 23 °C ± 2 °C with 50% ± 10% humidity and a 12-h light/12-h dark cycle, fed with standard chow from Xietong Pharmaceutical Bio-engineering Co. Ltd. (SFS9112) and free access to water under specific pathogen-free (SPF) conditions at the Zhejiang University Animal Care Facility according to the Institutional Guidelines for Laboratory Animals.
Crispr cas9
Manufactured by Cyagen
Sourced in China, United States
CRISPR/Cas9 is a genome editing tool that uses a guide RNA and the Cas9 enzyme to precisely target and modify specific DNA sequences. It enables researchers to efficiently alter DNA sequences and regulate gene expression.
Automatically generated - may contain errors
Lab products found in correlation
9 protocols using crispr cas9
1
Conditional Genetic Mouse Models
2
PGAM5-Deficient Mice with NAFLD/NASH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wildtype (WT) C57BL/6J mice were fed with control diet (Research Diets D12450J) and HFD (Research Diets D12492) for 20 weeks. Livers were harvested to detect the changes of PGAM5 protein. PGAM5-GKO C57BL/6J mice were constructed by CRISPR/Cas 9 at Cyagen company (China). Mice were housed in the specific pathogen-free (SPF) facility. PGAM5-GKO mice and their WT littermates were fed with high-fat diet (60% fat) and high-fructose (10%) drinking water (TROPHIC, Nantong, China) for 12 weeks or fed with MCD diet (MCS diet as control) (TROPHIC, Nantong, China) for 6 weeks to induce NAFLD/NASH. Male mice aged 8–14 weeks were used. And mice were fasted for 6 h before they were euthanized. N = 9–15/group. All of the animal experiments were approved by the Animal Research Committee of the Peking University People’s Hospital.
3
Ccdc157 Knockout Mice Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mice we used were C57BL/6. The Ccdc157 knockout allele was generated using CRISPR/Cas9 from Cyagen Biosciences Inc (China). The two gRNA were gRNA1 (matching reverse strand of gene): CTCTGAGAGCGGCCTATGGTGGG. gRNA2 (matching reverse strand of gene): GGGAGGATCCATCCAACCTAGGG. For genotyping of Ccdc157, genomic DNA from the tail of newborn mice was extracted, and PCR was carried out by the following primers, P1‐F: 5′‐GCTCTGCCTCCTTCTGAGTTAG‐3′; P1‐R:5′‐GTTTGTCTTCTGACCACACTCC‐3′; P2‐F: 5′‐CTCGTCTCAATAAACATGTGGG‐3′; P2‐R:5′‐CCACCTTTGTCTTTAGGTCACA‐3′. All mice were maintained in the standard specific pathogen‐free facility of the Animal Laboratory Center of Zhejiang University at a temperature at 22–24°Cand a 12 h dark/light cycle (light on from 7 a.m. to 7 p.m.). Four to five mice were kept per cage and could freely access to food and water ad libitum. The mice were sacrificed by cervical dislocation.
4
Conditional Knockout of LRRC8A in Myofibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the experiments involving the use of animals were approved by the Animal Use and Care Committee of the Fourth Military Medical University, Xi'an, China. The Lrrc8aflox/flox mice were established by the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 (Cyagen Biosciences Inc., Guangzhou, China). The exon 3 of the Lrrc8a gene was selected as the conditional KO region and the gRNA target sequences are as follows. gRNA1 (Lrrc8a reverse strand match): TGAGATAGTCCATGTAGCCCTGG. gRNA2 (Lrrc8a forward strand match): CAAAGTCGGGCTTAGATGGGTGG. To establish the conditional myofibroblast-specific LRRC8A knockout (CF-KO) mice, the Lrrc8aflox/flox mice were crossed with tamoxifen-inducible periostin-Cre (PostnMCM) mice (No. 029645, Jackson Laboratory, Marine, US). At 8-12 wk of age, the Lrrc8aflox/flox/PostnMCM mice were given a tamoxifen hydrochloride-contained chow diet (400 mg/kg, Harlan Teklad, US) for 28 d, followed by a regular chow diet for another 15 d to ensure the clearance of tamoxifen from the animals 18 (link). Lrrc8aflox/flox/PostnMCM/tamoxifen mice were the CF-KO, while Lrrc8aflox/flox/tamoxifen littermates were the wild-type (WT) control.
5
Genetically Modified Mice in Stroke Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All procedures fulfilled the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines on experimental design, animal allocation to different experimental groups, blinding of samples to data analysis, and reporting animal experiments. The GphnS268A/S270A mutant mouse was generated using CRISPR-Cas9 (Cyagen, USA) in BL6 background. These mutant mice develop normally and breed with Mendelian ratio. Heterozygous breedings were used to generate GphnS268A/S270A homozygous mutant mice; however, control C57Bl6/J-Crl1 mice were purchased from Charles River Laboratories (Germany). B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2) (stock no. 020940) (57 (link)) mice and Bdnftm3Jae or BDNFTg (stock no. 004339) (58 (link)) were obtained from the Jackson Laboratory, and heterozygous breeding pairs were set up to generate BDNFwt/wt/CX3CR1ERT2Cre+/− and BDNFflox/flox/CX3CR1ERT2Cre+/-cKO lines. We compared results within same genotypes. The mice were injected (intraperitoneally) on four consecutive days with tamoxifen dissolved in corn oil (H-6278, Sigma-Aldrich; 1 mg/day) to induce Cre expression at 4 weeks, followed by sham or MCAO surgery at 8 to 9 weeks of age. Animals were randomly assigned, and both genders were used for both conditions. The PLX5622 treatment for microglia depletion followed the recommended company dose (1200 mg of active form of PLX5622/kg of chow).
6
LPS-Induced Abortion in Transgenic Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adult male and female C57BL/6 mice (6–8 weeks old) were purchased from SIPPR/BK Laboratory Animal Company (Shanghai, China). Heterozygous SEC5-deficient (SEC5−/+) mice, constructed using CRISPR/Cas9, were purchased from Cyagen Biosciences (Suzhou, China). In short, SEC5 knockout was generated by pronuclear injection of C57BL/6 zygotes with 20 ng/μL Cas9 mRNA and two sgRNAs (10 ng/μL each; sgRNA 1 (5′-AAGGTTGTATACCTAGAGAC -3′) and sgRNA2 (5′-AATTCTAGAACTTTGCCCGC-3′)). SEC5−/+ mice were bred and genotyped. Genotypes were confirmed by PCR using the following primers: 5′-AAGTCAGGGGAGTAAAGTACACAC-3′ and 5′-CTCGTTATCTTTCACTGC AGTATCT-3’. All experiments were carried out in accordance with standard laboratory animal care protocols that were approved by the Institutional Animal Care Committee of Shanghai Institute for Biomedical and Pharmaceutical Technologies (#2018-14). Female mice were mated in natural cycling with males. Mice were inspected every morning for vaginal plugs. The day of vaginal plug detection was designated GD 0.5. Pregnant females were intraperitoneally injected with 250 μg/kg LPS (Sigma–Aldrich, St. Louis, MO, United States) at GD 7.5 to induce abortion. The control group was administered 100 μL of sterile saline solution. All mice were sacrificed at 24 h or 48 h after LPS treatment.
7
Generation of Tars2 Knock-in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tars2Flox/Flox knock-in mice were generated by homologous recombination using CRISPR/Cas9 by Cyagen (Suzhou) Biotechnology Co., Ltd. In short, a target vector containing the loxP-endogenous SA-Tars2 exon 4~18 CDS-polyA-SDA-Neo-SDA-loxP sequence was inserted into Intron 3, and the H138A (CAC to GCC) and H142A (CAT to GCT) mutations were introduced into Exon 4 in the 3′ homology arm. To express the mmtThrRS mutant in the whole mouse body, Tars2Flox/Flox mice were crossed with EIIa-Cre mice. Similarly, Tars2Flox/Flox mice were crossed with Myh6-Cre mice to obtain Tars2Flox/Flox-Cre mice with the mmtThrRS mutant specifically expressed in cardiomyocytes.
Detailed methods are described inSI Appendix, Materials and Methods .
Detailed methods are described in
8
Generating Soluble PRR using CRISPR
9
Microglia Depletion and Transient Ischemia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All procedures fulfilled the ARRIVE guidelines on experimental design, animal allocation to different experimental groups, blinding of samples to data analysis and reporting animal experiments. Littermates from heterozygous breedings were used within similar genotypes and inbred animal backgrounds. We compared results within same genotypes. The GphnS268A/S270A mutant mouse was generated using CRISPR/cas9 (Cyagen, USA) in BL6 background. B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2) (Stock 020940) 74 mice and Bdnftm3Jae or BDNF Tg (Stock 004339) 75 were obtained from Jackson Laboratory to generate BDNF wt/wt / CX3CR1 ERT2Cre+/-and BDNF flox/flox / CX3CR1 ERT2Cre+/-cKO lines. The mice were injected (i.p) on four consequtive days with tamoxifen dissolved in corn oil (Sigma H-6278; 1mg/ day) to induce Cre expression at 4 weeks followed by sham or MCAO surgery at 8-9 weeks of age. Animals were random assigned and both genders were used for both conditions. The PLX5622 treatment for microglia depletion followed recommended company dose (1200mg of active form of PLX5622/kg of chow).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!