Log In Sign up
The largest database of trusted experimental protocols

Dbh10 βelectrocompetent cells

Manufactured by New England Biolabs
Visit Supplier

DBH10 β-electrocompetent cells are a type of bacterial cells that have been prepared for efficient transformation via electroporation. These cells are designed to facilitate the introduction of DNA into the bacterial cells using an electrical pulse.

Automatically generated - may contain errors

Lab products found in correlation

Qiaquick gel extraction kit, by Qiagen (2 mentions) T4 ligase, by New England Biolabs (2 mentions) T4 ligase buffer, by New England Biolabs (2 mentions) Phosphonucleotide kinase, by New England Biolabs (2 mentions) Maxiprep kit, by Thermo Fisher Scientific (2 mentions) Minipreps, by Qiagen (2 mentions) Lb amp, by Qiagen (2 mentions)

2 protocols using dbh10 βelectrocompetent cells

1

Cloning SaCas9 sgRNA Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pAAV1-FLEX-SaCas9-sgRNA plasmid was digested overnight with BsaI-HFv2 and gel purified (Qiaquick Gel Extraction Kit, QIAGEN). The ordered sgRNA oligos were resuspended to a concentration of 100uM. The oligos were phosphorylated at 37°C for 30min using the following reaction: 1uL of each 100uM oligo, 1uL T4 ligase buffer (NEB), 0.5uL phosphonucleotide kinase (PNK, NEB) and 6.5uL H2O. To anneal the oligos, the entire reaction was placed at 100°C for 5 minutes and allowed to slowly return to room temperature. 50ng of digested pAAV-FLEX-SaCas9-sgRNA and 1uL T4 ligase (NEB) were added directly to the reaction and incubated at room temperature for 2 hours. 2uL of the reaction was electroporated using DBH10 βelectrocompetent cells (NEB). Colonies were grown in LB + AMP and minipreps (QIAGEN) were performed to extract DNA. A restriction digest using BsaI-HFv2 and HindIII-HF was performed to screen for positive colonies. One positive colony was selected and the DNA was extracted using a maxiprep kit (Invitrogen). The insertion of the sgRNA was confirmed via Sanger sequencing (Genewiz) using the following primer: 5′ GACTATCATATGCTTACCGT 3′.
Hunker A.C., Soden M.E., Krayushkina D., Heymann G., Awatramani R, & Zweifel L.S. (2020). Conditional Single Vector CRISPR/SaCas9 Viruses for Efficient Mutagenesis in the Adult Mouse Nervous System. Cell reports, 30(12), 4303-4316.e6.
+ Open protocol
+ Expand
2

Cloning SaCas9 sgRNA Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pAAV1-FLEX-SaCas9-sgRNA plasmid was digested overnight with BsaI-HFv2 and gel purified (Qiaquick Gel Extraction Kit, QIAGEN). The ordered sgRNA oligos were resuspended to a concentration of 100uM. The oligos were phosphorylated at 37°C for 30min using the following reaction: 1uL of each 100uM oligo, 1uL T4 ligase buffer (NEB), 0.5uL phosphonucleotide kinase (PNK, NEB) and 6.5uL H2O. To anneal the oligos, the entire reaction was placed at 100°C for 5 minutes and allowed to slowly return to room temperature. 50ng of digested pAAV-FLEX-SaCas9-sgRNA and 1uL T4 ligase (NEB) were added directly to the reaction and incubated at room temperature for 2 hours. 2uL of the reaction was electroporated using DBH10 βelectrocompetent cells (NEB). Colonies were grown in LB + AMP and minipreps (QIAGEN) were performed to extract DNA. A restriction digest using BsaI-HFv2 and HindIII-HF was performed to screen for positive colonies. One positive colony was selected and the DNA was extracted using a maxiprep kit (Invitrogen). The insertion of the sgRNA was confirmed via Sanger sequencing (Genewiz) using the following primer: 5′ GACTATCATATGCTTACCGT 3′.
Hunker A.C., Soden M.E., Krayushkina D., Heymann G., Awatramani R, & Zweifel L.S. (2020). Conditional Single Vector CRISPR/SaCas9 Viruses for Efficient Mutagenesis in the Adult Mouse Nervous System. Cell reports, 30(12), 4303-4316.e6.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!