Onetaq quick load 2x master mix

PCR amplifications were performed using OneTaq Quick-Load 2X Master Mix (New England BioLabs, Ipswich, MA, USA), 200 nM of each primer, and 10 ng of template DNA (25 µL total volume) following manufacturer’s instructions. After the initial denaturation step at 94 ${}^{\circ }$ C for 30 s, there were 30 cycles of 94 ${}^{\circ }$ C for 30 s, the respective annealing temperature for 60 s, and 72 ${}^{\circ }$ C for 60 s, and then finally 68 ${}^{\circ }$ C for 5 min. The positive control was gDNA of isolated cultures of B. infantis (DSM 20088) or of B. breve (DSM 20213) and the negative control contained water instead of a template DNA were included with each batch.

The oligonucleotide primers used in this study are given in Table-1 [12 (link)–20 (link)]. The PCR was carried out at 25 μL reaction volume using Master Mix (OneTaq^® Quick-Load^® 2X Master Mix with standard buffer, New England Biolabs, United States of America) following the manufacturer’s instructions. A thermal cycler (ProFlex gradient PCR, United States of America) was used to perform the PCR reaction. Thermal profiles of the PCR protocols designed to detect the causative agents of zoonotic diseases were carried out in 30 cycles using initial denaturation at 94°C for 30 s followed by denaturation at 94°C for 30 s; annealing at 56°C (MPB83 gene), 58.5°C (B1 gene), 55°C (Inlc gene), 59°C (IS1111 gene), and 55°C (IS711 gene) for 1 min, respectively, 62°C for 2 min (16S rRNA gene of MTBC), 57°C (H37RvHP gene), and 52°C (PA gene) for 1.5 min, respectively; extension at 68°C for 5 min; and final extension was carried out at 72°C for 5 min. The electrophoresis (WSE-1710Submerge-Mini2322100, China) was carried out on a 1.5% agarose gel containing ethidium bromide (0.5 g/mL), and images were captured using a transilluminator (Alpha imager, USA). The size of amplicons on agarose gels was determined using a 100 bp DNA ladder (TackIT, Invitrogen, USA).

Total DNA from bacterial isolates were extracted by using the Wizard® Genomic DNA Purification Kit (Promega) following manufacturer's instructions. DNA extractions were PCR-screened for the presence of the genetic determinants of previously reported antagonistic metabolites and virulence factors (Table S2). All PCR reactions were performed using the One Taq® Quick-Load 2X Master Mix with standard buffer (New England BioLabs) following the manufacturer's recommendations. Thermal cycling parameters were 5 min at 94°C, then 35 cycles of 1 min at 94°C, 1 min at the annealing temperature, followed by 1 min/kb of the PCR amplicon (Table S2) at 68°C, and finally, 10 min at 68°C. Reference strains used as positive controls for each PCR are indicated in Table S2. PCR amplicons were analyzed by agarose gel electrophoresis.

16S rRNA identification was performed for the characterisation of the isolated cyanobacteria with some modifications. Genomic DNA was extracted from the cultures received using the Quick-DNA™ Fungal/Bacterial Miniprep Kit (Zymo Research, Irvine, CA, USA, Catalogue No. D6005). The 16S target region was amplified using OneTaq^® Quick-Load^® 2X Master Mix (New England Biolabs (Ipswich, MA, USA), Catalogue No. M0486) with the cyano-primers CYA359F (5′GGGGAATCTTCCGCAATGGG-3′), CYA781R (a&b), CYA781Ra (5′-GACTACT GGGGTATCTAATCCCATT-3′), and CYA781Rb (5′-GACTACAGGGGTATCTAATCCCTTT-3′). The PCR products were run on a gel and gel-extracted with a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Catalogue No. D4001). The extracted fragments were sequenced in the forward and reverse direction (Nimagen, (Nijmegen, The Netherlands) BrilliantDye™ Terminator Cycle Sequencing Kit V3.1, BRD 3-100/1000) and purified (Zymo Research, ZR-96 DNA Sequencing Clean-up Kit™, Catalogue No. D4050). The purified fragments were analysed on an ABI 3500 XL Genetic Analyzer (Applied Biosystems, ThermoFisher Scientific, Waltham, MA, USA). A CLC Bio Main Workbench v 7.6 (Qiagen, Hilden, Germany) was used to analyse the .ab1 files generated by the ABI 3500 XL/ABI 3730 XL Genetic Analyzer, and results were obtained by a BLAST search (NCBI) [22 (link)].

Replacement of the native pdc promoter by the IPTG-inducible promoter P_T7A1 [22 (link)] in the Z. mobilis chromosome was achieved by homologous recombination using the suicide vector pZP950. Homology arms adjacent to the P_pdc on the chromosome were chosen to be 800 bp long and were flanking a spectinomycin resistance cassette as well as an expression cassette for lacI and the LacI-regulated promoter P_T7A1 [22 (link)]. Z. mobilis ZM4 was transformed with pZP950 via electroporation as previously described [9 (link)] and selection was carried out using 200 µg/ml spectinomycin on ZCM plates in the presence of 1 mM IPTG. Resulting colonies were tested on ZCM plates with and without 1 mM IPTG and colonies that only grew in the presence of IPTG were tested by colony PCR (see Additional File 1 for primer sequences) using OneTaq Quick-Load 2X Master Mix (New England Biolabs Inc., USA). The resulting homogenous strain with P_pdc replaced by P_T7A1 was named sGB027 (ZM4 ΔP_pd :: spR-lacI-P_T7A1).
Plasmids for either lactate dehydrogenase or alanine dehydrogenase expression were introduced into sGB027, resulting in strains sGB029 and sGB038, respectively.

The Arabidopsis T-DNA insertion lines SALK_043472C and WiscDsLox233237_13N (CS849339) in the OZ2 gene were ordered from the Arabidopsis Biological Resource Center (https://abrc.osu.edu/). After 3 days of stratification, seeds were planted in soil growing in a growth room (14 h of light/10 h of dark) at 26°C. Genotyping was done by polymerase chain reaction (PCR) with OneTaq Quick-Load 2X Master Mix (New England Biolabs) using primer pairs listed in Supplementary Table S1. The wild-type alleles were amplified using the primer pairs SALK_043472C-LP and SALK_043472C-RP, and CS84933-LP and CS84933-RP. The mutant alleles were amplified using the primer pairs SALK_043472C-RP and LBb1.3, and CS84933-RP and p745. The PCR products were sequenced at Cornell University Life Sciences Core Laboratories Center.

Primers to genotype the candidate variant were designed using Primer3Plus [47 (link)] (https://primer3plus.com/cgi-bin/dev/primer3plus.cgi) and checked for specificity by a BLAT search against the reference genome (ARS-UCD1.2). The primers Pair1_L (5’GCTTGGGATCTGACAAAGGA3’) and Pair1_R(5’TGGCCTCACGTTCTTCTTCT3’), synthesized at Macrogen Europe, amplified a 382bp fragment. Genomic DNA was extracted from blood samples using DNeasy Blood & Tissue Kit (Qiagen, Germany) according to the manufacturer’s instructions. A 25μl PCR mix was prepared using 12.5μl OneTaq Quick-Load 2X Master Mix (New England Biolabs) with Standard Buffer, 9.5μl of nuclease-free water, 0.5μl of each 10μM primer (Pair1_L and Pair1_R) and 2μl of genomic DNA extract. The PCR was performed using an AllInOneCycler (Bioneer) with the following conditions: initial denaturation at 94°C for 30 seconds; 30 cycles of denaturation at 94°C, annealing at 58°C and extension at 68°C for 30 seconds at each step; the final extension at 68°C for 5minutes. PCR products were sent to Macrogen Europe (Amsterdam, Netherlands) for sequencing.