Cd34 antibody

Manufactured by BD

Sourced in United Kingdom

The CD34 antibody is a laboratory tool used for the identification and isolation of CD34-positive cells. CD34 is a cell surface antigen expressed on hematopoietic stem and progenitor cells. The CD34 antibody can be used in various applications, such as flow cytometry and cell separation, to detect and isolate these cell populations.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Mouse FITC–conjugated anti-CD34 antibody (2 citations) Monoclonal CD34 antibody (clone 8G12; (2 citations) Anti-CD34-FITC antibody (2 citations) CD34-APC antibody (4 citations) Allophycocyanin (APC)-labeled anti-CD34 antibody (2 citations) Mouse anti-CD34 antibody (563) (2 citations) CD34 PerCP antibody (2 citations) PEconjugated anti-human CD34 antibody (4 citations) PE) -conjugated CD34 antibody (2 citations) Anti-human CD34-APC antibody (2 citations)

5 protocols using cd34 antibody

CD34+ Cell Isolation and Bisulfite Pyrosequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary samples were incubated for 15 min in phosphate-buffered saline (PBS) with 2% fetal calf serum and CD34 antibody (BD Biosciences, UK). After washing in PBS (+2% fetal calf serum) and DAPI, samples were filtered through a cell strainer and transferred to FACs tubes. Then, samples were sorted using BD FACS Aria II cell sorter (BD Biosciences, UK) into CD34⁺ and CD34⁻ cells. Bisulfite pyrosequencing was done as described (20 (link)) using the following primer sequences: forward, GGTTTTATTTAGGGTAGAGTAGATT; reverse (BIOTINYLATED), CCCCCTTCTTTCTATACCCAATACCATATC; sequencing primer, ACCAACTTACCCCAA.

Ghazaly E.A., Miraki-Moud F., Smith P., Gnanaranjan C., Koniali L., Oke A., Saied M.H., Petty R., Matthews J., Stronge R., Joel S.P., Young B.D., Gribben J, & Taussig D.C. (2020). Repression of sphingosine kinase (SK)-interacting protein (SKIP) in acute myeloid leukemia diminishes SK activity and its re-expression restores SK function. The Journal of Biological Chemistry, 295(16), 5496-5508.

+ Open protocol

+ Expand

Flow Cytometry and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD34 antibody (#555821) and CD38 antibody (#555460) for flow cytometry conjugated with biotin or specific dyes as required were purchased from BD Biosciences; γ-H2AX antibody was purchased from BioLegend (#613402). Western blot-related antibodies were purchased from Cell Signaling Technologies [GAPDH (#2118); BRCA1 (#9010); BRCA2 (#10741); DNA Damage Antibody Sampler Kit, (#9947); H2AX (#2595); CHK2 (#2662); ATM (#2873); ATR (#2790); Bcl2 (#15071) BIM (#2819); STAT3 (#9139); p-STAT3 (#9145)].

Xu Y., Lin Y., Luo Y., Yang Y., Long B., Fang Z., Liu L., Zhang J, & Zhang X. (2020). RAD52 aptamer regulates DNA damage repair and STAT3 in BRCA1/BRCA2-deficient human acute myeloid leukemia. Oncology Reports, 44(4), 1455-1466.

+ Open protocol

+ Expand

CML Mononuclear Cell Co-culture Assay

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mononuclear cells from CML patients (Table 1) were stained with 5-(and 6-) carboxy-fluorescein diacetate succinimidyl ester (CFSE, Life Technologies, Carlsbad, CA) as described [51 (link)]. They were then co-cultured with MSCs in αMEM /10%FCS medium [13 (link)]. After proliferating (CFSE^dim) and quiescent (CFSE^bright) cells became distinguishable, cells were either stained with CD34 antibody (BD Biosciences, San Jose, CA) and sorted (BD FACSAria^TM II sorter, BD Biosciences) into proliferating or quiescent fractions [14 (link)] or treated with nutlin3a, ABT-737, nilotinib, nutlin3a plus ABT-737, or nutlin3a plus nilotinib (Table 1) with or without MSCs.

Carter B.Z., Mak P.Y., Mak D.H., Ruvolo V.R., Schober W., McQueen T., Cortes J., Kantarjian H.M., Champlin R.E., Konopleva M, & Andreeff M. (2015). Synergistic effects of p53 activation via MDM2 inhibition in combination with inhibition of Bcl-2 or Bcr-Abl in CD34+ proliferating and quiescent chronic myeloid leukemia blast crisis cells. Oncotarget, 6(31), 30487-30499.

+ Open protocol

+ Expand

AML Cell Line and Primary Cell Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

SB415286 (SB) was obtained from Tocris Bioscience. Lithium, NBT, propidium iodide, 1,25D, SP600125, and noble agar were from Sigma-Aldrich. SB was used at 7.5 μmol/L, Lithium at 10mmol/L, and 1,25D at 5 nmol/L (low dose) or 25 nmol/L(high dose or unspecified). p-Serine, p-c-jun, actin, p-JNK, GSK3, p-MEK1/2, and p-p38 antibodies were obtained from Cell Signaling Technology. SRC3, cyclin A, and VDR antibodies were from Santa Cruz Biotechnology. P-208 VDR antibody was from Abcam. OCI-AML3 cells were obtained from DSMZ and 293T, HL-60, THP-1, Monomac-3, U937, and HeLa cells were obtained from ATCC (all cells were purchased in 2010). Upon receiving the cell lines, frozen stocks were prepared within 1 to 2 passages and new stocks were thawed frequently to keep the original condition. The cell lines were passaged for less than 6 months after receipt or resuscitation. They were also routinely authenticated on the basis of growth rate, morphology, and viability and were frequently confirmed to be mycoplasma-free.
Primary AML human bone marrow cells were obtained from the CWRU Hematopoietic Stem cell core facility. The AML samples that had fewer than 80% leukemic cells were purified by flow sorting (FACSAria) using CD34⁺ antibody (BD Biosciences). Guava ViaCount was obtained from Merck Millipore and used according to the manufacturer’s directions.

Gupta K., Stefan T., Ignatz-Hoover J., Moreton S., Parizher G., Saunthararajah Y, & Wald D.N. (2016). GSK-3 Inhibition Sensitizes Acute Myeloid Leukemia Cells to 1,25D-Mediated Differentiation. Cancer research, 76(9), 2743-2753.

+ Open protocol

+ Expand

Isolation and Purification of Rhesus Macaque HSPCs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rhesus macaque PBMCs were isolated from PB using Ficoll-Paque PLUS density gradient medium (GE Healthcare) following manufacturer recommendations. G-CSF-mobilized (Amgen) and plerixafor-mobilized (Amgen) rhesus macaque CD34⁺ HSPCs were collected as described previously.²⁹ (link)^,⁶⁰ (link) In short, the animals were treated with a 5-day course of 15 μg/kg G-CSF (Amgen) subcutaneously and a single subcutaneous dose of 1 mg/kg AMD3100 (Sigma-Aldrich) on the morning of the fifth day, 3–4 h before leukapheresis. A small-volume leukapheresis procedure was performed using a CS3000 cell separator (Baxter Fenwal), and CD34⁺ HSPCs were immunoselected using a rhesus macaque CD34⁺ antibody (clone 12.8, Fred Hutchinson Cancer Research Center) and an anti-mouse IgM bead (Miltenyi Biotech). A CD34⁺ antibody (550761, BD Biosciences) was used to determine the purity of the immunoselected population.

Peslak S.A., Demirci S., Chandra V., Ryu B., Bhardwaj S.K., Jiang J., Rupon J.W., Throm R.E., Uchida N., Leonard A., Essawi K., Bonifacino A.C., Krouse A.E., Linde N.S., Donahue R.E., Ferrara F., Wielgosz M., Abdulmalik O., Hamagami N., Germino-Watnick P., Le A., Chu R., Hinds M., Weiss M.J., Tong W., Tisdale J.F, & Blobel G.A. (2023). Forced enhancer-promoter rewiring to alter gene expression in animal models. Molecular Therapy. Nucleic Acids, 31, 452-465.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!