Anti nf ya

Total RNA was isolated from cells using 0.5 mL Trizol, and reverse transcription quantitative PCR was performed using the Prime-Script RT Master Mix (Vazyme, China). qRT-PCR was performed using SYBR Green Realtime PCR Master Mix (Vazyme, China). Samples from each experiment were independently repeated three times. The sequences were as follows: CDCA8: Forward, TTGACTACTTCGCCCTTG, Reverse, CTTCTTCTTCCTCTTCCACTA; TPM3: Forward, 5′-GCACATTGCA GAAGAGGCAG-3′; Reverse, 5′-TCTGTGCGTTCCAAGTCTCC-3′; USP13: Forward, 5′-GCCAAGCACTTAGCGCATTT-3′; Reverse, 5′-CACTTCCCACTCA CTGACCC-3′; NECAP2: Forward, 5′-AACAAGCCCAGAACCCAGAC-3′, Reverse, 5′-CCAGCTGCTCCTTCCTTCTT-3’; SPRYD4: Forward, 5′-CAAGCTGGGGAAC AGCCATA-3′, Reverse, 5′-GAATTTCTGCCCCTTCACGC-3′.
The primary antibodies used in this study were as follows: anti-CDCA8 (Santa Cruz, sc-376635), anti-NF-YA (Santa Cruz, sc-17753), anti-MEK1/2 (CST, 4694), anti-Phospho-MEK1/2 (CST, 9154), anti-p44/42 (CST, 4695), anti-Phospho-p44/42 (CST, 4377), anti-p38 (CST, 8690), anti-rabbit IgG (CST, 4413), and anti-mouse IgG (CST, 7076).

Scrambled control (shSC), NF-YA (shNF-YA) and NF-YB (shNF-YB) shRNAs were cloned into the pLKO.1 vector (Sigma Aldrich). Viral supernatants expressing sh-scramble (control vector), sh-NF-YA and sh-NF-YB were prepared by transfecting HEK293T packaging cells. Briefly, shRNA plasmids and second generation packaging plasmids (VSVG and pCMV-dR8.74) were transfected into HEK293T cells. Lentivirus-containing supernatants were collected 48 h after transfection, filtered and frozen until use.
Hela cells were transduced with sh-SC or sh-NF-YA or sh-NF-YB, treated with DMSO or TSA (final concentration 2μM) 54 hours after transduction, and collected at 18 hrs after treatment. Knockdown and treatment efficiency were assayed by PCR on cDNAs and by Western blot analysis on whole cell protein extracts using anti-NF-YA (Santa Cruz), anti NF-YB (GeneSpin), anti H3K9Ac (Abcam) and anti-Vinculin (Sigma) antibodies. Total RNA was prepared by Trizol extraction and reverse transcribed using the Iscript cDNA Synthesis kit (BIORAD 170-8890).

For Western blotting and ChIP of Sp1, Sp2 and Sp3 in MEFs, we used homemade rabbit antibodies [7 (link),42 (link)] affinity-purified against the respective recombinant Sp factor. Anti-Sp3 antibodies (Santa Cruz, sc-644) were used for the Western blot shown in Fig. 3B, and anti-Sp2 antibodies (Santa Cruz, sc-643) for ChIP-seq of Sp2 in HEK293 cells. Additional antibodies: Anti-Nf-ya (Santa Cruz, sc-10779), anti-Nf-yb (Genespin, PAb001), anti-Nf-yc (Santa Cruz, sc-7715-R), anti-Flag M2 (Sigma, F3165), anti-Tubulin (Millipore, MAB3408).

Total cell extracts were obtained by lysis in RIPA buffer as described [28 (link)]. Cellular fractionation was performed as described in [40 (link)]. Western Blot were performed as described [26 (link), 28 (link)] using following primary antibodies: mouse anti-hnRNP F/H (dilution 1:1000, Abcam), anti-VIMENTIN (dilution 1:2000, Sigma Aldrich), anti-TUBULIN (dilution 1:1000, Sigma Aldrich), anti-NEK2 (dilution 1:500, Santa Cruz), anti-NF-YA, anti-HSP90a/b, anti-GAPDH, anti-SRSF1 (dilution 1:1000, Santa Cruz); goat anti-MATRIN3 (1:500, Santa Cruz); rabbit anti-H3 (dilution 1:1000, Abcam) and anti-E-CADHERIN (1:1000, Cell Signalling). Densitometric analysis were performed using Alliance system software (UVITEC, Cambridge).

For whole cell lysates, cells were resuspended in 1X SDS sample buffer (25mM Tris–HCl pH 6.8, 1.5mM EDTA, 20% glycerol, 2% SDS, 5% b-mercaptoethanol, 0.0025% Bromophenol blue). For Western blot analysis, equal quantity of cell lysates were separated by SDS-polyacrylamide gel electrophoresis, transferred to PVDF membrane (VWR) and probed with the following primary antibodies: anti-NF-YA (Santa Cruz, sc-17753), anti-NF-YB (GeneSpin), anti-p53 (Santa Cruz, sc-126), anti-PARP1 (Santa Cruz, sc-8007), anti-H2AX (Santa Cruz, sc-101696), anti-p21 (Millipore, 05-345), anti-E2F1 (Bethyl, A300-766A), anti-cJun (Bethyl, A302-958A), anti-cMyc (Santa Cruz, sc-764), anti-Fos (Santa Cruz, sc-52), anti-p63 4A4 (Santa Cruz, sc-A0311), anti-actin (Santa Cruz, sc-1616), anti-tubulin (Sigma Aldrich, T-6074), anti-E6 (Santa Cruz, sc-365089). Chemiluminescent detection reagent was purchased from Millipore Spa (Luminata Classico and Forte Western HRP).