Hcd45 apc

Infection of BLT mice with HIV-1 was monitored in peripheral blood by determining levels of viral RNA in plasma by one-step real-time reverse transcriptase PCR assay, using the following primers: CATGTTTTCAGCATTATCAGAAGGA, TGCTTGATGTCCCCCCACT, and the MGB-probe carboxyfluorescein (FAM)-CCACCCCACAAGATTTAAACACCATGCTAA-Q (nonfluorescent quencher) (Applied Biosystems) (sensitivity of 400 HIV RNA copies/ml). The percentage of human CD4+ T cells in peripheral blood of BLT mice before challenge (0–2 weeks prior to exposure) and after challenge was determined by flow cytometry with respective antibodies: hCD45-APC, hCD3-FITC, hCD4-PE and hCD8-PerCP (eBioscience). Flow cytometry data were collected using a BD FACSCanto cytometer and analyzed using BD FACSDiva software. The presence of viral DNA in tissues and peripheral blood collected from BLT mice was determined by real-time PCR analysis of DNA extracted from 5×10⁴–4×10⁶ cells from harvested tissue (spleen, lymph nodes, bone marrow, liver, lung, female reproductive tract) or from 15–50μl peripheral blood cells, as previously described [23 (link), 26 (link), 27 (link), 51 (link)]; (assay sensitivity of 10 DNA copies per sample).

The proportion of human immune cells in the peripheral blood (weeks 16–20 after hCD34⁺ transfer and at the end of the study) was determined by FACS analysis. Heparinized blood (100 µl) was taken from the tail vein. After lysis of erythrocytes cells were washed in PBS with 10% FCS (FACS buffer), stained with fluorochrome-labeled monoclonal antibodies (mAb) to hCD45-APC, hCD3-PE, hCD4-APC (ebioscience, Germany), hCD8-PE (Exbio Praha, Czech Republic), mCD45-FITC (BioLegend, CA, USA), and analyzed by FACS analysis using an Accuri C6 flow cytometer (BD Biosciences, Germany). At the end of the study cell suspensions were prepared from the spleen and bone marrow as described previously^{32 (link), 33 (link)}. After lysis of erythrocytes 3 × 10⁵ cells from bone marrow or spleen were suspended in 100 µl FACS buffer and stained for 30 min with mAb to determine the frequency of murine (mCD45-FITC) and human (hCD45-APC) cells carrying leukocyte common antigen (expressed on all hematopoietic cells) and T cells (human CD3-PE, human CD4, human CD8). After two washing steps in FACS buffer cells were analyzed on Accuri C6. Matched isotype antibodies served as controls.