Taqman quantitative pcr

MDM2 amplification in baseline tumour biopsies was assessed by TaqMan quantitative PCR (Applied Biosystems), using RNAseP as the reference gene (MDM2 probe Hs01463512_cn, TaqMan Copy Number Reference Assay RNase P). Relative quantitation was performed using the ΔΔCt method and a normal healthy human donor DNA sample was used as the calibrator. Amplification was defined as having greater than five copies of MDM2 using the mean of triplicate measurements. Tumour mutation profile was assessed using the Ion AmpliSeq Cancer Hotspot Panel v2 (Life Technologies). Tumours were sequenced to a median coverage of at least × 19,000. Mutations were called using MuTect17 (link), Strelka18 (link) and SomaticIndelDetector (http://www.broadinstitute.org/cancer/cga/). Oncotator11 (link) was used to annotate mutation calls. Tumours were declared TP53 wild type if no non-synonymous mutations were called.

Total RNA was extracted from cultured cells using a miRNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The qRT-PCR method has previously been described [21 (link)]. PCR was performed in 96-well plates using a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), and all reactions were performed in triplicate. TaqMan® qRT-PCR kits and human-CD63 and human-β-actin TaqMan® Expression Assays were purchased from Applied Biosystems (Foster City, CA, USA). Reverse transcription (Applied Biosystems, Foster City, CA, USA) and TaqMan® quantitative PCR (Applied Biosystems, Foster City, CA, USA) were performed according to the manufacturer’s instructions. SYBR® Green I qRT-PCR was performed, and the β-actin housekeeping gene was used to normalize the variation in the cDNA levels. The primer sequences are as follows (shown 5′ to 3′): human β-actin, GGCACCACCATGTACCCTG (Forward) and CACGGAGTACTTGCGCTCAG (Reverse); and human RPN2, ATCTAACCTTGATCCCAGCAATUGTG (Forward) and CTGCCAGAAGCAGATCTTTGGTC (Reverse).

Total RNAs were extracted from cultured cells using the QIAzol and miRNeasy Mini Kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer’s protocol. PCR was performed in 96-well plates using the 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). All reactions were performed in triplicate. TaqMan qRT-PCR kits and human E-cadherin and human β-actin TaqMan Expression Assays were purchased from Applied Biosystems (Foster City, CA, USA). Reverse transcription (Applied Biosystems, Foster City, CA, USA) and TaqMan quantitative PCR (Applied Biosystems, Foster City, CA, USA) were performed in accordance with the manufacturer’s instructions. SYBR Green I qRT-PCR was performed, and the β-actin housekeeping gene used to normalise the variation in the cDNA levels. The following pairs of primers were used for gene amplification: for vimentin, 5′-TCTGGATTCACTCCCTCTGG-3′ (forward) and 5′-GGTCATCGTGATGCTGAGAA-3′ (reverse); for c-Met, 5′-CAGGCAGTGCAGCATGTAGT-3′ (forward) and 5′-GATGATTCCCTCGGTCAGAA-3′ (reverse); and for β-actin, 5′-ACTCTTCCAGCCTTCCTTCC-3′ (forward) and 5′-AGCACTGTGTTGGCGTACAG-3′ (reverse).

For gene expression analysis of reactive oxygen species (ROS) associated genes, apical cultured cells of the triple co-culture (Caco-2 and HT29-MTX-E12) were harvested after 2 h and 24 h exposure. The RNA was isolated using the RNeasy Micro Kit (product code 74004, Qiagen, Hilden, Germany) according to the manufacturer’s instructions. cDNA was generated by reverse transcription of up to 500 ng RNA using the High-Capacity cDNA Reverse Transcription Kit (product code 4368814, Applied Biosystems^®, Foster City, CA, USA) according to the manufacturer’s instructions. Gene expression was measured via the 5′-nuclease assay (TaqMan™) quantitative PCR (qPCR) of 2.5 ng DNA using a QuantStudio™ 7 Flex system with QuantStudio™ RealTime PCR-software (Version 1.3, Applied Biosystems^®, Foster City, CA, USA) and TaqMan™ assays CAT (Assay ID Hs00156308_m1) and GPX1 (Assay ID Hs02516751_s1). Relative quantification was calculated with the 2^−∆∆CT method using HPRT1 (Assay ID Hs99999909_m1) as endogenous reference for normalization. The level of expression was evaluated in comparison with the chosen housekeeping gene HPRT1. The data calculation was performed in Excel (Microsoft Office 2010, Excel 2016).

cDNA of the non-cleavable cFLIP_L was a kind gift from Prof. Inna Lavrik. cDNAs of wild-type or mutant FLIP variants, Tax, and N-terminally HA-tagged FADD were cloned into pDual (see Fig. 1B). Vesicular stomatitis virus G glycoprotein pseudotyped lentiviral particles were produced by co-transfection of HEK293T cells with pDual, pCMV8.91 (HIV gag-pol), and pMDG (vesicular stomatitis virus G glycoprotein). Supernatants were passed through 0.45-μm filters and concentrated 100-fold by ultracentrifugation at 100,000 × g at 4 °C for 2 h in a Sorvall centrifuge (Beckman Coulter). Viral pellets were resuspended in cold whole medium, incubated on ice for 1–2 h, aliquoted, and stored at −80 °C. Titers were measured on HEK293T cells by fluorescence-activated cell sorting (FACS) analysis and TaqMan quantitative PCR (Applied Biosystems, Warrington, UK). For experiments, cells were transduced with test cFLIP, vFLIP, and Tax lentivectors at identical multiplicities of infection within experiments and in the range of 1–20 or 50–500 for 293/293T or 70Z/3, respectively.