Sc 6954

Cells were cultured on coverslips and were treated with 10 μM VP-16 for the indicated times. Cells were then washed with PBS, fixed with 4% paraformaldehyde for 10 min at room temperature, and were subsequently permeabilized in 0.5% Triton X-100 solution for 10 min. After being blocked by 5% BSA, cells were incubated with primary antibodies overnight and subsequently secondary antibodies for 1 h. Coverslips were then mounted using DAPI containing anti-fade. Images were captured using a Leica SP8 Laser confocal optical imaging platform. Images were processed using Leica Application Suite X. The percentage of cells carrying indicated foci was calculated after analyzing three independent experiments. Approximately 150 cells were counted for each sample. Antibodies used for immunofluorescent staining are as follows: anti-gamma-H2AX (Abcam; Mouse; ab22551; 1:100 dilution), anti-Rad51(Abcam; Rabbit; ab133534; 1:400 dilution), anti-Brca1(Santa Cruz Biotechnology; Mouse; sc-6954; 1:100 dilution), and anti-FLAG (Cell Signaling Technology; Rabbit; #14793; 1:200 dilution). The following secondary antibodies were used: Alexa Fluor 488 Goat Anti-Mouse (Life Technologies; A-11008; 1:1000) and Alexa Fluor 594 Goat Anti-Rabbit (Life Technologies; A-11012; 1:1000).

Cells were crosslinked with 1% formaldehyde for 10 min and then quenched by 0.125 M glycine for 5 min at room temperature. Fixed cells were lysed with ChIP lysis buffer 1 (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8.0, 1% Triton X-100, and 0.1% DOC) on ice and lysis buffer 2 (10 mM Tris pH 8.0, 200 mM NaCl, 1 mM EDTA, and 0.5 mM EGTA) at room temperature. Chromatin was digested with micrococcal nuclease (MNase Cell Signaling, Cat#: 10010) in digestion buffer (10 mM Tris pH 8.0, 1 mM CaCl2, and 0.2% Triton X-100) at 37 °C for 15 min. Nucleus products were broken down by Bioruptor pulse at high frequency. The following antibodies were used for ChIP: anti-BRCA1 antibody (Santa Cruz, sc-6954, RRID:AB_626761; 5 μg/IP) and anti-BRCA2 antibody (Cell Signaling, 10741, RRID:AB_2797730; 10 μL/IP). ChIP DNA was purified by the ChIP DNA clean and concentrator kit (Zymo Research, Cat#: D5205) and analyzed by qPCR. Primers targeting the MGAT5 promoter were used for ChIP–qPCR are purchased from Integrated DNA Technologies; human MGAT5 promoter forward (5″-GTCTCCTCTGACTTCAACAGCG -3″) and human MGAT5 promoter Reverse (5″- ACCACCCTGTTGCTGTAGCCAA -3″).