Pureyield plasmid miniprep system kit

MiR-22-3p and miR-132 precursors were inserted into the psiUX expression vector (kindly provided by Prof. I. Bozzoni, Università di Roma La Sapienza, Rome, Italy). GBA and GBAP1 3′UTRs were directionally cloned downstream of the renilla luciferase gene in the psiCHECK2 reporter plasmid (Promega, Madison, USA). All constructs were produced by PCR amplifying the relevant genomic region from the DNA of a healthy subject using an appropriate PCR primer couple (Supplementary Table 3), and subsequently by cutting the amplified products with the proper restriction enzyme. Restricted products were ligated into the relevant plasmid.
The constructs carrying the GBA and GBAP1 3′UTR deleted of the miR-22-3p binding site (ΔMRE) were obtained by site-directed mutagenesis, by means of the QuikChange kit (Agilent Technologies, Santa Clara, USA), following the manufacturer protocol.
A pGL3-control luciferase construct containing a single perfectly-complementary miR-22-3p antisense sequence (miR-22-3p sensor), kindly provided by Dr. Da-Zhi Wang (Children's Hospital Boston and Harvard Medical School), was used as a positive control^{27 (link)}.
All plasmids were purified using the PureYield™ Plasmid Miniprep System kit (Promega) according to the manufacturer’s instructions. All recombinant and mutagenized vectors were verified by conventional Sanger sequencing, as described^{10 (link)}.

A plasmid with a human recombinant manganese SOD sequence (Gene Bank accession no. NM_000636) was constructed by amplifying SOD cDNA with the following primers: forward CTAGCAAGCTTCCATGTTGAGCCGGGCA and reverse: 5′GTTGCACGCGTCTTTTTGCAAGC3′. The primers encompass the restriction enzymes sites HindIII (forward) and MluI (reverse), given in italics. The resulting amplified DNA fragments (690 bp) were digested with appropriate restriction enzymes (HindIII and MluI) and cloned into pEX-C-His (OriGene) under T7 promoter. The resulting plasmid contained the cDNA of human manganese SOD with a His-tag on the C-end of the protein. The plasmid was then transferred into E. coli XL-stain to identify the best clones by growth on plates with ampicillin selection medium. Plasmids were isolated from several of the resulting colonies, purified by PureYield™ Plasmid Miniprep System kit (Promega), and sequenced. The best constructs were transferred to E. coli BL-STAR stain for protein expression.

Isolation of the bacterial genomic DNA was performed using either the Wizard^®Genomic DNA Purification Kit (Promega, Madison, WI, USA) or the JetFlex Genomic DNA Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA). Plasmid DNA isolation was performed with a Pure Yield Plasmid MiniPrep System kit (Promega). Isolated DNA samples were stored at −20 °C for further analysis.

The purified PCR products were cloned into pGEM-T vector (Promega, Madison, WI, USA) using T4 DNA ligase (Promega) according to the manufacturer’s instructions, followed by transformation into Escherichia coli DH5α competent cells [11 ]. Ten recombinant colonies were selected on screening media and confirmed by colony PCRs. Plasmid DNAs were extracted using the PureYield plasmid miniprep system kit (Promega) following the manufacturer’s instructions and were bi-directionally sequenced using an Applied Biosystems 3730 DNA Analyzer.