Biomax transcreen he

Total RNA was isolated by using Trizol solution according to the manufacturer’s protocol. Northern blot analysis for IE1 and IE2 mRNAs was conducted using total RNA that was separated on a 1.2% agarose formaldehyde gel and then transferred using Whatman TurboBlotter Rapid Downward Transfer Systems. IE1 and IE2 probes were generated by PCR using cDNA from TB40E infected NHDFs (as template) and labelled with Amersham Rediprime II DNA labelling system (GE Healthcare) with the following primers (IE1: TCAAACAGATTAAGGTTCGAGTGG, and ATCCACATCTCCCGCTTATCCTCG; IE2: TCATGGTGCGCATCTTCTCCACC, and TTACTGAGACTTGTTCCTCAGGTCC). After hybridization and wash, the membranes were exposed to autoradiography film with an intensifying screen (Biomax Transcreen HE, Kodak) for visualization of bands.

RNA was isolated according to TRI reagent^® protocol (Sigma-Aldrich, USA) and then frozen at −80°C for further preparation. The quality of RNA samples was assessed by gel electrophoresis, and quantitative analysis was performed using a GeneQuant spectrophotometer (Pharmacia, Sweden). Absorption was measured at a 260-nm wavelength, and 1 OD was equivalent to 40 μg of RNA. Reverse transcription of RNA and cDNA labeling were performed with the BD RiboQuant™ RPA system (BD Bioscences-Pharmingen, San Jose, CA, USA) and CDS Primer Mix (BD Biosciences, Clontech, Palo Alto, CA, USA). PCR reaction was then performed using the BD Atlas™ NucleoSpin^® extraction kit. In order to perform gene expression profiling, Atlas Human Cancer 1.2 array membranes were used (cDNA Expression Array PT3547-3E; BD Biosciences, Clontech; cat. no. 7851-1). These macroarray membranes contain 1,176 hybridization points for various genes, of which 31 are specific for ECM proteins. Hybridization reactions were performed according to the kit manual, and then membranes were transferred to the exposure cassette BioMax TranScreen HE with Kodak BioMax MS film (Kodak, USA). Exposure times varied and depended on the isotopic activity of the cDNA (between 4 and 7 days). Film development was performed with Kodak liquid developers (Kodak). Results were digitally read with AtlasImage™ software (BD Biosciences, Clontech).