Plasmids expressing murine caspase-1 and caspase-3 with C-terminal Myc and DDK (FLAG) tags (pCMV6 entry) and empty vectors for expression of N-terminal Myc-DDK (pCMV6-AN-Myc-DDK) and N- and C-terminal His (pCMV6-AN-His and pCMV6-AC-His, respectively) tagged proteins were obtained from Origene Technologies. Murine caspase-11 open reading frames were cloned from LPS-primed J774A.1 mRNA and caspase-1 truncation constructs were cloned from the caspase-1 vector. Plasmids were transfected into HEK293T cells using Lipofectamine LTX PLUS (Invitrogen), and cell lines stably expressing the proteins of interest were selected with G418 (400 μg/ml). His-tagged proteins were purified using Ni-sepharose FF6 resin (GE Healthcare) according to the manufacturer’s instructions.
Pcmv6 ac his
Manufactured by OriGene
PCMV6-AC-His is a lab equipment product offered by OriGene. It is a plasmid vector that allows for the expression of proteins with a C-terminal 6xHis tag in mammalian cell lines.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine ltx plus, by Thermo Fisher Scientific (1 mentions)
Pcmv6 an myc ddk, by OriGene (1 mentions)
Escherichia coli xl10 gold, by Agilent Technologies (1 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
Jetprime reagent, by Polyplus Transfection (1 mentions)
Pcmv6 entry, by OriGene (1 mentions)
2 protocols using pcmv6 ac his
1
Caspase Expression and Purification
2
Cloning and Mutagenesis of Ecsit and Ndufaf1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length Ecsit clone (Dharmacon MMM1013-202766953) was ligated into pCMV6-AC-HIS (Origene—PS10002) vector following incorporation of flanking restriction enzyme sites by PCR (SgfI—AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, Tm, 80.1°C, MluI—GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG—Tm 72.0°C, expected amplicon size 1693 bp, MGI:1349469) and grown in XL-10 Gold Escherichia coli (Agilent). Site-directed mutagenesis (Q5-SDM—NEB) was utilized to introduce the N209I mutation (Forward—CGATTCAAGATTATCAACCCCTAC—Tm 62.1°C, Reverse—GGTGAACCACAGCTTCATC—Tm 61.5°C, expected amplicon size 7595 bp). Full-length Ndufaf1 (Dharmacon MMM1013-202762755) was similarly incorporated into pCMV6-Entry (Origene—PS10001, SgfI—GAGGCGATCGCCATGTCTTCCATTCACAAATTACT—Tm 73.6°C, MluI—GCGACGCGTTCTGAAGAGTCTTGGGTTAAGAA—Tm 72.0°C, expected amplicon size 1472 bp, MGI:1916952). Vector DNA isolated by QIAprep Spin Miniprep kit (Qiagen).
pCMV6-AC-HIS-Ecsit (wild type or EcsitN209I), pCMV6-Entry-TRAF6, pCMV6-Entry-ACAD9, and pCMV6-Entry-NDUFAF1 were transfected into Hek293T cells using jetPRIME reagent (Polyplus). Hek293T cells were plated at 2.5 × 105 cells/well (six-well plate) in DMEM (high glucose, glutamax, 10% FBS, 100 U/mL penicillin–streptomycin).
pCMV6-AC-HIS-Ecsit (wild type or EcsitN209I), pCMV6-Entry-TRAF6, pCMV6-Entry-ACAD9, and pCMV6-Entry-NDUFAF1 were transfected into Hek293T cells using jetPRIME reagent (Polyplus). Hek293T cells were plated at 2.5 × 105 cells/well (six-well plate) in DMEM (high glucose, glutamax, 10% FBS, 100 U/mL penicillin–streptomycin).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!