Total RNA was isolated from BV2 cells using the total RNA extraction kit (RNeasy, Qiagen). cDNA was synthesized from 1 μg RNA using Oligo dT, dNTPs and Superscript III (Invitrogen). qPCR was performed using Syber Green reagents (Applied Biosystems) and the following primers (forward; reverse) for mouse: Nos2 (5′-gtggtgacaagcacatttgg-3′; 5′-aaggccaaacacagcatacc-3′), Il-1β (5′-gctgcttccaaacctttgac-3′; 5′-ttctccacagccacaatgag-3′), II-6 (5′-ggaccaagaccatccaattc-3′; 5′-ggcataacgcactaggtttg-3′), Mmp14 (5′-tccggataagtttgggactg-3′; 5′-cattatgctgccacttgagg-3′), Ccl22 (5′-ctgatgcaggtccctatggt-3′; 5′-gcaggattttgaggtccaga-3′), Chil3 (5′-cagggtaatgagtgggttgg-3′; 5′-cacggcacctcctaaattgt-3′), Sirt1 (5′-aaacagtga gaaaatgctgg-3′; 5′-ggtattgattaccctcaagc-3′), Mof (5′-tgacagaagtagataggcaag-3′; 5′-agcttagagagctcataactg-3′) and β-actin (5′-ttgctgacaggatgcagaag-3′; 5′-tgatccacatctgctggaag-3′). QPCR was run on ABI 7500 and β-actin was used as housekeeping gene for normalization.
Syber green reagent
Manufactured by Thermo Fisher Scientific
Sourced in Australia, United States
Syber Green reagents are a type of nucleic acid stain used in molecular biology and biotechnology applications. They bind to double-stranded DNA and emit a fluorescent signal upon excitation, allowing for the detection and quantification of DNA molecules. These reagents can be used in various techniques, including real-time PCR, gel electrophoresis, and DNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Oligo dt, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (1 mentions)
Icycler iq5, by Bio-Rad (1 mentions)
7900ht fast real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Pcr master mix, by Thermo Fisher Scientific (1 mentions)
Rotor gene 6000, by Qiagen (1 mentions)
Primescript rt reagent kit with cdna eraser, by Takara Bio (1 mentions)
Abi 7900 real time pcr detection system, by Thermo Fisher Scientific (1 mentions)
Mastercycler, by Eppendorf (1 mentions)
7 protocols using syber green reagent
1
qPCR Analysis of Inflammatory Markers in BV2 Cells
2
Quantitative Expression Analysis of LIN28A, KRAS, and microRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative RNA expression was analyzed by real-time PCR analysis in triplicate with SYBER Green reagents (Applied Biosystems, Foster City, CA) per manufacturer's instructions on an I-Cycler IQ5 real-time detection system (Bio-Rad, Hercules, CA). Expression levels were determined using the delta/delta CT method and then normalized to either β-ACTIN or 18S rRNA. Primer sequences were as follows: human LIN28A forward: CGGGCATCTGTAAGT, reverse: CAGACCCTTGGCTGA; human β-ACTIN forward: CCCAGCACAATGAAGATCAA, reverse: GATCCACACGGAGTACTTG; human 18S forward: GTAACCCGTTGAACCCCATT, reverse: CCATCCAATCGGTAGTAGCG; human KRAS forward: GGGGAGGGCTTTCTTTGTGT, reverse: GTCCTGAGCCTGTTTTGTGTC. Relative expression of microRNAs, mature let-7a, b, and g were quantified using Taqman MicroRNA Assay (Life Technologies) per the manufacturer's instructions. Expression levels were normalized to 18S rRNA.
3
Quantitative PCR Analysis of Gene Expression
4
Quantitative RT-PCR Analysis of DRG Inflammation
5
Quantitative Real-Time PCR of S1P Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR was carried out using the Rotor Gene 6000 (Corbett Research, Corbett Life Science, Concorde, NSW 2137, Australia) and Syber Green reagents (Life Technologies), consisting in a specific set of primers (200 nM) and a fluorogenic internal probe. The expression of S1PR genes was quantitated in comparison with the housekeeping gene GAPDH [17 (link)]. PCR amplifications were performed on cDNA samples corresponding to a final RNA concentration of 50 ng. PCR was performed in a total volume of 25 μl containing 2 × PCR Master mix (Life Technologies). Reaction conditions were as follows: 95°C for 10 min, followed by 35–40 cycles at 95°C for 15 s alternating with 52°C or 55°C or 60°C for 1 min and 72°C for 45 s. PCR amplifications were run in duplicates. Blank controls were performed in each run.
For the evaluation of S1PR4 and S1PR5 mRNA expression, double amount of cDNA (4 μl) was used and 40 cycles of amplification performed. The results of the real-time PCR were determined as Ct values, where Ct was defined as the PCR threshold cycle at which amplified product was first detected. All values were normalized to the GAPDH housekeeping gene expression and ∆Ct calculated [17 (link)]. The ratio between the fold of variation of S1P receptor expression obtained from high- and low-density BM-MSCs culture is reported.
For the evaluation of S1PR4 and S1PR5 mRNA expression, double amount of cDNA (4 μl) was used and 40 cycles of amplification performed. The results of the real-time PCR were determined as Ct values, where Ct was defined as the PCR threshold cycle at which amplified product was first detected. All values were normalized to the GAPDH housekeeping gene expression and ∆Ct calculated [17 (link)]. The ratio between the fold of variation of S1P receptor expression obtained from high- and low-density BM-MSCs culture is reported.
6
Quantifying mRNA Levels in Prostate Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from DU145 and PC-3 cells using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and reverse transcribed into cDNA using a PrimeScript RT reagent kit with cDNA Eraser (TaKaRa, Dalian, China). Reverse transcription (RT) products were used as templates for subsequent qPCR.
The following primers were used in this study:
The mRNA levels of the target genes were analyzed by the ABI7900 Real-Time PCR Detection System (Applied Biosystems, Foster City, CA, USA) with Syber Green reagent (Thermo Fisher Scientific). GAPDH was used as an internal control for normalization. The specificity of the fluorescence signal was confirmed by both melting curve analysis and agarose gel electrophoresis. The mRNA levels of target genes were determined by the 2−ΔΔCt method.
The following primers were used in this study:
The mRNA levels of the target genes were analyzed by the ABI7900 Real-Time PCR Detection System (Applied Biosystems, Foster City, CA, USA) with Syber Green reagent (Thermo Fisher Scientific). GAPDH was used as an internal control for normalization. The specificity of the fluorescence signal was confirmed by both melting curve analysis and agarose gel electrophoresis. The mRNA levels of target genes were determined by the 2−ΔΔCt method.
7
Quantitative PCR Analysis of Murine and Human TLR4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard methods were used for real-time qPCR with Syber Green reagent (ThermoFisher Scientific) on an Eppendorf Mastercycler instrument. The comparative cycle threshold method was used for quantification (fold increase = 2-ΔΔct). Primers were: murine TLR4 sense (5’-CCAAGCCTTTCAGGGAATTAA-3’), murine TLR4 antisense (5’-GCCAGGTTTTGAAGGCAAGT-5’), murine GAPDH sense (5’-CATCTTCTTGTGCAGTGC-3’), murine GAPDH antisense (5’-CGGCCAAATCCGTTCAC-3’); human GAPDH sense (5’-GGGAAGGTGAAGGTCGGA-3’); human GAPDH antisense (5’-GCAGCCCTGGTGACCAG-3’); human TLR4 sense (5’-GTCTGCAGGCGTTTTCTTCT-3’); human TLR4 antisense (5’-AAGTGAAAGCGGCAACCTTA-3’). GAPDH mRNA levels were used for normalization.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!