Log In Sign up
The largest database of trusted experimental protocols

Qiaamp viral rna columns

Manufactured by Qiagen
Visit Supplier

The QIAamp® viral RNA columns are lab equipment designed for the isolation and purification of viral RNA from various sample types. The columns utilize a silica-based membrane technology to efficiently capture and elute viral RNA for downstream analysis.

Automatically generated - may contain errors

Lab products found in correlation

Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (2 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Expand high fidelity pcr system, by Roche (1 mentions)

Close spelling variants of this product

QIAamp Viral RNA (30 citations) QIAamp columns (9 citations) RNA columns (2 citations)

3 protocols using qiaamp viral rna columns

1

Viral Sequence Analysis of Transmitted Founder HIV

Check if the same lab product or an alternative is used in the 5 most similar protocols
Viruses replicating in infected animals were identified by sequence analysis. Viral RNA was isolated from plasma using QIAamp viral RNA columns (Qiagen) according to the manufacturer’s protocol, and cDNA was generated using Superscript III Reverse Transcriptase (Invitrogen) with the primer GTGGGTACACAGGCATGTGTGG. cDNA was amplified by nested PCR using the Expand High Fidelity PCR System (Roche). PCR primers were designed to anneal in regions with the fewest possible primer mismatches to HIVJR-CSF, HIVCH040, HIVRHPA and HIVTHRO sequences. Primer sequences were as follows: outer forward primer, TGCATATTGTGAGTCTGTTACTATGTTTACT; reverse prime CAGGAGCAGATGATACAG; inner forward primer, GTAGGACCTACACCTGTCAAC; reverse primer CCTGCAAAGCTAGGTGAATTGC. Amplified viral DNA was sequenced and compared to sequences of transmitted/founder viruses.
Kovarova M., Council O.D., Date A.A., Long J.M., Nochii T., Belshan M., Shibata A., Vincent H., Baker C.E., Thayer W.O., Kraus G., Lachaud-Durand S., Williams P., Destache C.J, & Garcia J.V. (2015). Nanoformulations of Rilpivirine for Topical Pericoital and Systemic Coitus-Independent Administration Efficiently Prevent HIV Transmission. PLoS Pathogens, 11(8), e1005075.
+ Open protocol
+ Expand
2

One-step RT-qPCR for HIV-RNA Quantification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For tissue RNA analysis, RNA was extracted using QIAamp® viral RNA columns (Qiagen) according to the manufacturer’s protocol including an optional treatment with RNase-free DNase and analyzed using one-step reverse transcriptase real-time PCR [ABI custom TaqMan™ Assays-by-Design]42 (link). Known quantities of HIV gag RNA standards were run in parallel, creating a standard curve for HIV gag and sample RNA was quantified by extrapolation from the standard curve. All samples were run and analyzed on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems™). Due to the relatively low number of human cells found in the brain, HIV-RNA levels were quantified for only three vehicle control and three AZD5582-treated animals.
Nixon C.C., Mavigner M., Sampey G.C., Brooks A.D., Spagnuolo R.A., Irlbeck D.M., Mattingly C., Ho P.T., Schoof N., Cammon C.G., Tharp G.K., Kanke M., Wang Z., Cleary R.A., Upadhyay A.A., De C., Wills S.R., Falcinelli S.D., Galardi C., Walum H., Schramm N.J., Deutsch J., Lifson J.D., Fennessey C.M., Keele B.F., Jean S., Maguire S., Liao B., Browne E.P., Ferris R.G., Brehm J.H., Favre D., Vanderford T.H., Bosinger S.E., Jones C.D., Routy J.P., Archin N.M., Margolis D.M., Wahl A., Dunham R.M., Silvestri G., Chahroudi A, & Garcia J.V. (2020). Systemic HIV and SIV latency reversal via non-canonical NF-κB signalling in vivo. Nature, 578(7793), 160-165.
+ Open protocol
+ Expand
3

One-step RT-qPCR for HIV-RNA Quantification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For tissue RNA analysis, RNA was extracted using QIAamp® viral RNA columns (Qiagen) according to the manufacturer’s protocol including an optional treatment with RNase-free DNase and analyzed using one-step reverse transcriptase real-time PCR [ABI custom TaqMan™ Assays-by-Design]42 (link). Known quantities of HIV gag RNA standards were run in parallel, creating a standard curve for HIV gag and sample RNA was quantified by extrapolation from the standard curve. All samples were run and analyzed on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems™). Due to the relatively low number of human cells found in the brain, HIV-RNA levels were quantified for only three vehicle control and three AZD5582-treated animals.
Nixon C.C., Mavigner M., Sampey G.C., Brooks A.D., Spagnuolo R.A., Irlbeck D.M., Mattingly C., Ho P.T., Schoof N., Cammon C.G., Tharp G.K., Kanke M., Wang Z., Cleary R.A., Upadhyay A.A., De C., Wills S.R., Falcinelli S.D., Galardi C., Walum H., Schramm N.J., Deutsch J., Lifson J.D., Fennessey C.M., Keele B.F., Jean S., Maguire S., Liao B., Browne E.P., Ferris R.G., Brehm J.H., Favre D., Vanderford T.H., Bosinger S.E., Jones C.D., Routy J.P., Archin N.M., Margolis D.M., Wahl A., Dunham R.M., Silvestri G., Chahroudi A, & Garcia J.V. (2020). Systemic HIV and SIV latency reversal via non-canonical NF-κB signalling in vivo. Nature, 578(7793), 160-165.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!