Rnaiso plus

Oryza sativa subsp. Indica was grown and maintained in a green house under controlled conditions of a 32°C temperature, 70–80% humidity, and a 16/8 hours day–night cycle. Old leaf materials (35–42 days, 300 mg) were collected and ground to fine powder using liquid nitrogen in a pre-chilled mortar–pestle. RNA was extracted using RNAiso Plus (Takara Bio, Kusatsu, Shiga, Japan) reagent by following the method as mentioned previously (Guria et al., 2019 (link)).
HeLa cells were obtained from NCCS Pune, India, and were maintained under an atmosphere of 37°C, 5% CO₂ in RPMI-1640 media (with L-Glutamine, Gibco, Thermo Fisher Scientific, Waltham, MA, United States) supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific, Waltham, MA, United States) and 1% penicillin–streptomycin (HiMedia, Mumbai, Maharashtra, India) antibiotics. The cells were harvested in 1 ml of RNAiso Plus (Takara Bio, Kusatsu, Shiga, Japan) using a cell scrapper upon reaching 70–80% confluent state. The collected HeLa cells were passed four to five times through a 1 ml syringe in order to lyse the cells, and total RNA was isolated using RNAiso Plus (Takara Bio, Kusatsu, Shiga, Japan) using the manufacturer’s protocol.

HUVEC cells cultured in 12‐well plate were transfected with mimic/mimic NC (RioboBio), inhibitor/inhibitor NC (RioboBio) or treated with TGF‐β1 at 10 ng/mL (Sigma)/TGF‐β1+ inhibitor. 48 hours later, cells were lysed with RNAiso plus (TaKaRa), while cardiac tissues were lysed with RNAiso plus and homogenized. Total RNA was reverse‐transcribed into cDNA using M‐MLV reverse transcription kit (Vazyme). qRT‐PCR was conducted with AceQ qPCR SYBR Green Master Mix (Q141‐02/03, Vazyme) on the ABI StepOnePlus™ Real‐Time PCR System. The primers sequence is as follows: SMAD7, 5′‐GGACGCTGTTGGTACACAAG‐3′, 5′‐GCTGCATAAACTCGTGGTCATTG‐3′; α‐SMA, 5′‐CAGGGGGCACCACTATGTAC‐3′, 5′‐CGGCTTCATCGTATTCCTGTT‐3′; CD31, 5′‐CGTGGTCAACATAACAGAACTA‐3′, 5′‐GTCCGACTTTGAGGCTATCT‐3′; β‐actin, 5′‐GGACTTCGAGCAGGAGATGG‐3′, 5′‐GCACCGTGTTGGCGTAGAGG‐3′.
For reverse transcription and qRT‐PCR analysis of miR‐21, two different Bulge‐Loop™ miRNA qRT‐PCR Primer sets were used to detect the transcriptional level of miR‐21, Bulge‐Loop™ miR‐21 qPCR Primer Set and Bulge‐Loopies™ U6 qPCR Primer Set (RioboBio).

Total RNA for amplification of P450 cDNA fragments was isolated from the abdomen of adult
D. helophoroidesusing RNAiso Plus (Takara Bio,
www.takarabio.com). Five adult individuals were dissected to remove their abdomens, which then were ground with liquid nitrogen until becoming a powder. The powder was quickly transfered into a 1.5mL centrifuge tube and homogenized with 1mL RNAiso Plus (Takara). The process of total RNA extraction and purification was carried out according to the manufacturer’s instructions. The total RNA (A260/A280 = 1.865) was dissoved in 20 µL DEPC treated H2O and stored at -80°C. The first strand of cDNA was synthesized using 2 µg of the total RNA using a TIANScript First Strand cDNA Synthesis Kit (Tiangen Biotech,
www.tiangen.com) following the manufacturer’s instructions. The reaction mixture was stored at -20°C.