Typhoon phosphorimager

The CCT6 locus was chosen because it is the strongest Spo11‐induced DSB hotspot in the synthetic region (Pan et al, 2011). Cells were harvested and DNA was extracted as described (Oh et al, 2009), except that no cross‐linking step was performed. The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions. Southern blot hybridization was performed at 65°C in Church buffer (1% BSA, 0.25 M Na₂HPO₄ pH 7.3, 7% SDS, 1 mM EDTA) with a 1,104‐bp‐long radiolabeled probe corresponding to the rightmost region common to both the native and the Syn‐HiC restriction fragments (obtained from SK1 genomic DNA with primers 5′‐TGGTGAAGAACTCAGGATTC‐3′ and 5′‐CAGTTACAATGAAGTCCAGG‐3′) and radiolabeled phage lambda DNA (molecular ladder). Radiolabeling was performed with ³²P‐αdCTP with the High Prime labeling kit (Roche) following the manufacturer's instructions. The membrane was washed and exposed overnight, and the storage Phosphor Screen (GE Healthcare) was scanned on a Typhoon PhosphorImager (Molecular Dynamics). The length of the native and Syn‐HiC parental fragments is 5,135 and 6,157 bp, respectively. CO formation generates two recombinants of 4,453 and 6,839 bp. Quantifications were performed with ImageJ 1.49v.

In vitro self-cleavage reactions were performed as follows. Separate solutions of the PAGE-purified ³²P-labeled ribozyme (6 μL) and a physiological-like MgCl₂ buffer (25 μL of 140 mM KCl, 10 mM NaCl, 50 mM Tris-HCl, pH 7.5) were pre-incubated at 37 °C. A zero timepoint was collected by taking 1 μL of the ribozyme solution and immediately quenching prior to addition of any magnesium by adding it to 6 μL of denaturing quench buffer (8 M urea, 20 mM EDTA, with 0.05% xylene cyanol, 0.1% bromophenol blue, and 1 mM Tris, pH 7.5). Folding and self-cleaving reactions were initiated by adding the ribozyme (5 μL) to the reaction buffer (25 μL). Aliquots (3 μL) taken at different time points were quenched with 6 μL of the denaturing quench buffer. The reactions were then fractionated using 7.5% PAGE. The resulting gels were exposed to phosphorimage screens (Molecular Dynamics) and analyzed by using a Typhoon phosphorimager. ImageQuant software (GE Healthcare) was used to measure observed band intensities to derive the population of each fragment size at a given timepoint. These data were used to model the progress of the initiated cleavage reaction over time.

TFO binding was determined by footprinting the 73-mer DNA fragment shown in Supplementary Figure S1f. This was performed by mixing 1.5 μl radiolabelled DNA with 3 μl TFO dissolved in either 50 mM sodium acetate containing 10 mM MgCl₂ at pH 5.0, or 40 mM tris acetate containing 10 mM MgCl₂ at pH 7.5. Final TFO concentrations varied between 0.03 and 30 μM and the complexes were left to equilibrate overnight at 20°C. DNase I digestion was carried out by adding 2 μl DNase I (typically 0.01 U/ml) dissolved in 20 mM NaCl containing 2 mM MgCl₂ and 2 mM MnCl₂. The reaction was stopped after 1 min by adding 4 μl of 80% formamide containing 10 mM EDTA, 10 mM NaOH and 0.1% (w/v) bromophenol blue. Products of digestion were separated on 12% (w/v) polyacrylamide gels containing 8 M urea. Samples were heated to 100°C for 3 min, before rapidly cooling on ice and loading onto the gel. Polyacrylamide gels (40 cm long and 0.3 mm thick) were run at 1500 V for ∼2 h and then fixed in 10% (v/v) acetic acid. These were transferred to Whatman 3MM paper and dried under vacuum at 86°C for 1 h. The dried gels were subjected to phosphorimaging using a Molecular Dynamics Typhoon PhosphorImager.

The Sln1-HK domain bound to glutathione-Sepharose 4B resin was phosphorylated via incubation with 0.66 μM [γ-³²P]-ATP (3000 Ci/mmol) for 30 min according to previously published protocols [19 (link)]. Unincorporated [γ-³²P]-ATP was washed from phospho-Sln1-HK with 50 mM Tris-HCl, pH 8.0, 100 mM KCl, 15 mM MgCl₂, 2 mM DTT, and 20% glycerol by three consecutive centrifugations (1 min at 1000 g). Sln1-R1 was added to the reaction and incubated for 5 min with phospho-Sln1-HK. Sln1-HK was removed from the reaction through gentle centrifugation, leaving only phosphorylated Sln1-R1 in solution. Phospho-Sln1-R1 was then used as a donor to phosphorylate all Ypd1 proteins. Ypd1 proteins were phosphorylated by incubation with an equimolar concentration of Sln1-R1 for 5 min. To test the ability of the Ypd1-G68X mutants to transfer the phosphoryl group to downstream binding partners, Ypd1~P was incubated with an equimolar concentration of Ssk1-R2 and an aliquot was obtained at 5 min. The reaction was quenched with stop buffer containing EDTA and samples were separated on a 15% SDS polyacrylamide gel and electrophoresed at 200 V for 45 min for visualization. The SDS gels were wrapped in plastic wrap and exposed to a phosphorimager screen. The radioactivity of each band was quantified using a Typhoon phosphorimager (Molecular Dynamics). Band intensities were quantified using ImageJ [71 ].