Geneamp xl pcr kit
The GeneAmp XL PCR kit is a reagent-based product designed for performing polymerase chain reaction (PCR) amplification of DNA sequences. The kit contains the necessary components, such as primers, polymerase, and buffers, to facilitate the DNA amplification process.
Lab products found in correlation
13 protocols using geneamp xl pcr kit
Quantitative PCR for DNA Integrity
Quantifying Mitochondrial DNA Damage
(Forward primer: GAGCGTCATTTATTGGGAAGAAGA
Reverse primer: TGTGCTAATCCCATAAATGTAACCTT).
Quantitative Mitochondrial DNA Damage Assay
Quantifying DNA Integrity via qPCR
Detecting mtDNA Mutations and Damage
LX-PCR assay was performed to determine DNA damage using GeneAmp XL PCR kit (Applied Biosystems, CA, USA) as previously described (Wu et al., 2015 (link)). DNA damage was quantified by comparing the ratio between the long and short fragments of PCR amplicons (mtDNA = 210 bp/13.4 kb).
Quantitative PCR for Mitochondrial and Nuclear DNA Damage
Quantitative PCR for DNA Integrity
BCR Pathway Mutation Analysis in DLBCL
Nested PCR for cDNA amplification
Quantifying Mitochondrial DNA Damage via Extended PCR
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!