Cells (2000–5000) were sorted directly into Trizol LS (Thermo Fisher Scientific). Total RNA was extracted and reverse-transcribed using iScript reverse transcription supermix (Bio-Rad). Real-time PCR was performed using the iTaq Universal SYBR Green supermix (Bio-Rad) using a CFX384 real-time PCR machine (Bio-Rad). Transcript levels were normalized to Actin (Actb) using the ΔCt method. The primers used for qPCR analysis are listed in Supplemental Table S3 .
Cfx384 real time pcr machine
Manufactured by Bio-Rad
Sourced in United States
The CFX384 real-time PCR machine is a high-performance instrument designed for quantitative PCR (qPCR) analysis. It features a 384-well format and can perform real-time detection and analysis of nucleic acid samples. The core function of the CFX384 is to enable precise and reliable quantification of target DNA sequences in a variety of sample types.
Automatically generated - may contain errors
Lab products found in correlation
M mlv reverse transcriptase, by Thermo Fisher Scientific (6 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
E220 sonicator, by Covaris (4 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Itaq universal sybr green supermix, by Bio-Rad (2 mentions)
Mirneasy kit, by Qiagen (2 mentions)
Control igg, by Santa Cruz Biotechnology (2 mentions)
Ab8580, by Abcam (2 mentions)
Ab4729, by Abcam (2 mentions)
Sybr green, by Bio-Rad (2 mentions)
Ab16502, by Abcam (2 mentions)
Trizol ls, by Thermo Fisher Scientific (2 mentions)
Sensifast cdna synthesis kit, by Meridian Bioscience (2 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Iscript reverse transcription supermix, by Bio-Rad (1 mentions)
Rneasy mini or micro kit, by Qiagen (1 mentions)
Steponeplus, by Thermo Fisher Scientific (1 mentions)
38 protocols using cfx384 real time pcr machine
1
RNA Extraction and qPCR Analysis
2
Real-Time PCR Genotyping of V1016I Locus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AS‐PCR for the V1016I locus was based on the method reported by Saavedra‐Rodriguez et al. (2007 (link)) and modifications to the I1016R primer made by the Entomology Branch at the Centers for Disease Control and Prevention (CDC), Atlanta, USA (A. Lenhart, personal communication). The PCR volume was reduced to 10 µl per reaction and contained 2.5 µl of dH2O, 0.5 µl of each primer at 10 µM (V1016F, I1016F, I1016R), 5 µl of PerfeCTa SYBR Green Supermix (Quanta—95054‐02K), and 1 µl of template. The primer sequences for V1016F and I1016F used are reported in Saavedra‐Rodriguez et al. (2007 (link)), but the primer sequence for I1016R was modified to: 5’ ‐ TGA TGA ACC SGA ATT GGA CAA AAG C – 3’ (CDC, personal communication). Samples were genotyped on a Bio‐Rad CFX384 Real‐Time PCR machine in the GSL, with the following thermal conditions: step 1—95°C for 3 min, step 2—95°C for 10 s, step 3—60°C for 10 s, step 4—72°C for 10 s, step 5—go to step 2, 39 times, step 6—95°C for 10 s, and step 7—melting curve 65–95°C, increment 0.2°C per 10 s plus a plate read.
3
RNA Isolation and qRT-PCR Analysis of Hepatocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from iPSC-derived hepatocyte-like cells and primary human hepatocytes using the RNeasy mini or micro kits (QIAGEN). Genomic DNA was removed using 1 μl of RNase-free DNaseI per 5 μg of RNA. First-strand cDNA was synthesized using Moloney murine leukemia virus reverse transcriptase with dNTPs and random hexamer primers. qRT-PCR was performed using either StepOne Plus (Applied Biosystems/Thermo Fisher Scientific) or CFX-384 real-time PCR machine (Bio-Rad) with PrimeTime assays (Table S4 ) (Integrated DNA Technologies) following the manufacturer's protocols.
4
miRNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRNAs and total RNAs were extracted using Trizol and were cleaned using miRNeasy kit (Qiagen, Valencia, CA, USA). miRNAs were measured using Taqman MicroRNA Reverse Transcription Kit and Taqman Universal Master Mix Kit (Applied Biosystems, Carlsbad, CA, USA). All SYBR-based real-time PCRs were run on a CFX96 or CFX384 Real-Time PCR machine (Bio-Rad, Hercules, CA, USA) with iScript reverse transcription kit and iTaq supermix (Bio-Rad). A list of SYBR-based real-time PCR primers can be found in the Supplementary Table .
5
Quantification of HACE1 Expression in Gastric Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA of the six gastric cell lines and HEK293T, and then, reverse transcription was performed using Superscript II reverse transcriptase (Toyobo, Japan). Quantitative PCR amplification was finished using SYBR Green (Toyobo, Japan) on a CFX384 real‐time PCR machine (Bio‐Rad, Richmond, CA, USA). The primer of HACE1 for qPCR was produced by Boshang Biotech Company, Shanghai, China, and GAPDH which was used as normal control. The primer sequences of each gene were as follows: HACE1: 5′‐GAGAGAGCGATGGAGCAACT‐3′ and 5′‐ACAGCAAAACCAAGCATTCC‐3′; GAPDH: 5′‐GAGTCAACGGATTTGGTCGT‐3′ and 5′‐TGGAAGATGGTGATGGGATT‐3′.
6
ChIP-qPCR analysis of chromatin-binding proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) was performed on cells crosslinked with 1% formaldehyde for 5 minutes at 37°C, quenched with 2 mol/L glycine and washed with PBS, and then sonicated in a Covaris E220 sonicator to generate 300–600 bp DNA fragments. Immunoprecipitation was performed using a control IgG (Santa Cruz Biotechnology) and antibodies against MUC1-C (Cell Signaling Technology, catalog no. 16564, RRID:AB_2798765), JUN (Abcam, catalog no. ab32137, RRID:AB_731608), ARID1A (Cell Signaling Technology, catalog no. 12354, RRID: AB_263710), PBRM1 (Cell Signaling Technology, catalog no. E6N2K), EP300 (Cell Signaling Technology, catalog no. D2X6N), H3K27ac (Abcam, catalog no. ab4729, RRID:AB_2118291), H3K4me1 (Abcam, catalog no. ab8895, RRID:AB_306847), and H3K4me3 (Abcam, catalog no. ab8580; RRID:AB_306649). Precipitated DNAs were detected by PCR using primers listed in Supplementary Table S3. Quantitation was performed on immunoprecipitated DNA using SYBR-green and the CFX384 Real-Time PCR Machine (Bio-Rad). Data are reported as fold enrichment relative to IgG (8 (link)).
7
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using ISOLATE-II RNA MiniKits (Bioline, London, UK) with on-column DNase treatment. RNA was quantified using a Nanodrop (BioTek, Winooski, VT), and reverse-transcribed using a SensiFAST cDNA synthesis kit (Bioline). cDNA was amplified in triplicate with gene-specific primers (Invitrogen) using a CFX384 real-time PCR machine (BioRad). Thermal cycling conditions were 95 °C for 2 min, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Data were analysed using the ΔΔCt method with expression normalized to the housekeeping gene and sham-operated animals used as the referent controls.
8
ChIP-qPCR Analysis of Epigenomic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed on cells crosslinked with 1% formaldehyde for 5 min at 37 °C, quenched with 2 M glycine, washed with PBS, and then sonicated in a Covaris E220 sonicator to generate 300–600 bp DNA fragments. Immunoprecipitation was performed using a control IgG (3900S, CST) and antibodies against MUC1-C (#16564S, CST), NF-κB p65 (#ab16502, Abcam), H3K27ac (#ab4729, RRID:AB_2118291, Abcam), and H3K4me3 (#ab8580; RRID:AB_306649, Abcam). Precipitated DNAs were detected by PCR using primers listed in Supplementary Table S2 . Quantitation was performed on immunoprecipitated DNA using SYBR-green and the CFX384 real-time PCR machine (Bio-Rad, Berkeley, CA, USA). Data are reported as a percentage of input DNA for each sample.
9
Vav1 Transgene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the lung lobe, liver, and gut of Rosa Vav1 mice after Vav1 transgene induction, using TRI reagent (Sigma Kiryat HaMada, Jerusalem, Israel), and the miRNeasy Kit (QIAGEN, Maryland, MD, USA) according to the manufacturer’s instructions. cDNAs were prepared using the qScript reverse transcriptase (Quanta, Taipei, Taiwan). Quantitative PCR (qPCR) was performed by using the CFX-384 real-time PCR machine (Bio-Rad, Hercules, CA, USA) to detect Vav1 transgene, mVAV1, and GFP using cyber green PCR master mix (Bio-Rad, Hercules, CA, USA) and the required primers (Supplementary Table S1B ). Three independent experiments were performed, and in each experiment, triplicates were used.
10
Allele-Specific PCR for F1534C Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AS‐PCR for the F1534C locus was performed following the method reported by Yanola et al. (2011 (link)) with the following modifications. The PCR volume was reduced to a total of 10 µl per reaction and contained 5 µl dH2O, 0.2 µl C1534F primer, 0.4 µl F1534F primer, 0.4 µl F1534R primer, 3.0 µl of PerfeCTa SYBR Green Supermix (Quanta—95054‐02K), and 1 µl of template. Samples were genotyped on a Bio‐Rad CFX384 Real‐Time PCR machine in the GSL, with the following thermal conditions: step 1—95°C for 2 min, step 2—95°C for 30 s, step 3—60°C for 30 s, step 4—72°C for 30 s, step 5—go to step 2, 34 times, step 6—72°C for 2 min, and step 7—melting curve 65–95°C, increment 0.2°C per 10 s plus a plate read.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!