Qiaamp dna micro kit

Germ-free flies were generated following established protocols^{41 ,91 (link)}. In detail, the embryo was dechorionated in 2.5% sodium hypochlorite in 0.05%Tween 20 in PBS (PBT) for 2 min. Embryos were subsequently washed three times in PBT, followed by washing with PBS three times. The embryos were maintained in vials with axenic food that contained antibiotics (40 μg/mL ampicillin, 100 μg/mL tetracycline, 8.3 μg/mL erythromycin, 40 μg/mL chloramphenicol). The presence of bacteria was checked using genomic PCR analysis and plating on agar medium from fly homogenates. Three whole flies were lysed in lysis buffer (ATL, QIAamp DNA Micro Kit, QIAGEN), sonicated by beads (Pathogen Lysis Tubes L, QIAGEN) for 45 min at 4 °C and purified using QIAamp DNA Micro Kit after overnight incubation at 56 °C. 16S rRNA primers (8FE: AGAGTTTGATCCTGGCTCAG and 519R:GWATTACCGCGGCKGCTG, 341F:CCTACGGGNGGCWGCAG and 805R:GACTACHVGGGTATCTAATCC) were used for genomic PCR. For plating, three flies were homogenized in PBS and the homogenate was diluted 1:10, applied to MRS or mannitol medium, and incubated for 2–3 days at 30 °C.

After extraction in acetone, specimens were dried and placed in tubes filled with 200 μl of lysis buffer (QIAamp^® DNA Micro Kit, Qiagen) containing Proteinase K, and crushed using a micro-homogeniser. Samples were incubated overnight at 56°C, and genomic DNA extracted using a silica-membrane-based nucleic acid technique (QIAamp^® DNA Micro Kit, Qiagen, Germany). Genomic DNA was further purified using the OneStep^TM PCR Inhibitor Removal (Zymo Research, Germany). Extracted DNA concentration and purity were quantified using DropSense 96 (Trinean, United States). Only 41 out of 71 samples produced enough purified genomic DNA suitable for microbiome analysis. In total, DNA was recovered from 12 samples collected in April at each depth (6- and 18-m), and in January only nine samples were collected from 6-m and eight samples from 18-m.

Tumor DNA was extracted from the FFPE samples or fresh frozen tissues using QIAmp DNA FFPE Tissue Kit (Qiagen, Venlo, The Netherland) or QIAamp DNA Micro Kit (Qiagen). Germline DNA was extracted from peripheral blood leukocytes using QIAamp DNA Micro Kit (Qiagen). The purified DNA was quantified using Qubit 2.0 Fluorometer and NanoDrop 2000c spectrophotometer (both Thermo Fisher Scientific, MA, USA).

The genomic DNA (gDNA) was extracted using the QIAamp DNA Micro Kit (Quiagen) from the pellet of in vitro cultured cells, or with QuickExtract (Epicentre) from cultivated cells in MethoCultOptimum H4034, following the instructions provided by the manufacturer. The efficiency of B2M PE was assessed using Sanger sequencing (performed by Eurofins Scientific) and the EditR software (available at http://baseeditr.com). To adapt EditR for B2M prime editing, we used as input the sequence TGGCCTTAGCTGTGCTCGC and selected the reverse complement orientation option as described in Fuimara et al^{23 (link)}. The efficiency of DNMT3A R882H PE was assessed by ddPCR. QX200 Droplet Digital PCR System was used to examine 10–50 ng of gDNA for in vitro samples and 4 μl of gDNA for colonies in accordance with the manufacturer’s instructions. The VAF was calculated as the number of FAM-positive droplets divided by total droplets containing a target. The primers and probes are enumerated in (Supplementary Table 3).