RNA extraction, reverse transcription, and qPCR were conducted based on the RNA extraction kit (Cat# R401-01), HiScript III All-in-on RT SuperMix (Cat# R333-01), and ChamQ Universal SYBR qPCR kit (Cat# Q711-02) from Vazyme, China, respectively. One microgram of RNA was used for each reverse transcription reaction. The qPCR reactions were conducted by a BIO-RAD CFX Real-Time PCR machine. The baseline threshold, automatically calculated by Bio-Rad CFX Manager (Version 3.1), was adopted to retrieve the quantification cycle (Cq) values. GAPDH was used as the reference gene for normalization. Primers for GAPDH, vimentin, KRT16, and KRT18 are shown in Supplementary Table 5 .
Rna extraction kit
Manufactured by Vazyme
Sourced in China
The RNA extraction kit is a laboratory product designed to isolate and purify RNA from biological samples. It provides a standardized procedure for efficient and consistent extraction of RNA, which is a crucial step in various molecular biology applications, such as gene expression analysis, reverse transcription-PCR, and RNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Reverse transcription kit, by Vazyme (6 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (4 mentions)
Cdna synthesis kit, by Vazyme (3 mentions)
Taq pro universal sybr qpcr master mix kit, by Vazyme (2 mentions)
Quantstudio 7 flex, by Thermo Fisher Scientific (2 mentions)
Sybr qpcr master mix, by Vazyme (2 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Life technology abi 7500 system based on sybr green pcr kit, by Thermo Fisher Scientific (2 mentions)
Cfx manager version 3, by Bio-Rad (1 mentions)
Chamq universal sybr qpcr kit, by Vazyme (1 mentions)
Cfx real time pcr machine, by Bio-Rad (1 mentions)
Cell counting kit 8 cck 8, by Merck Group (1 mentions)
Lipopolysaccharides (lps), by Merck Group (1 mentions)
Dulbecco s modified eagle medium dmem, by Cytiva (1 mentions)
Sybr qpcr reagent, by Vazyme (1 mentions)
Penicillin streptomycin antibiotic, by Thermo Fisher Scientific (1 mentions)
Cdna reverse transcription kit, by Vazyme (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rnase free dnase 1, by Takara Bio (1 mentions)
63 protocols using rna extraction kit
1
RNA Extraction and qPCR Analysis
2
LPS-Induced Cell Response Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lipopolysaccharides (LPS) (purity ≥ 99%) were purchased from Sigma, Dulbecco’s Modified Eagle medium (DMEM) was purchased from Cytiva, and penicillin-streptomycin antibiotics (1000 IU/mL penicillin and 1000 μg/mL streptomycin) were purchased from Gibco, and fetal bovine serum (FBS) was purchased from HyClone. Cell Counting Kit 8 (CCK-8) was purchased from Sigma. RNA extraction kit, cDNA reverse transcription kit, and SYBR qPCR reagent were purchased from Vazyme Biotech Co., Ltd. (Nanjing, China). The sequences of all primers were purchased from Shanghai Sangong (Shanghai, China). All other reagents were analytically pure.
3
Quantitative Real-Time PCR Analysis of Plant Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the qRT-PCR experiment, total RNA was extracted from plant tissues using an RNA extraction Kit (Vazyme, Nanjing, China). Genomic DNA was degraded with RNase-Free DNaseI (TaKaRa, Tokyo, Japan) by incubation in the supplied buffer for 20 min at room temperature. The purity and integrity of the RNA were determined by agarose gel electrophoresis and the A260/A230 and A260/A280 ratios. To generate first-strand cDNA, 1 μg of total RNA was reverse transcribed using a Clontech kit (TaKaRa, Tokyo, Japan) according to the manufacturer’s protocol. The cDNA was used as a template for quantitative real-time PCR (qRT-PCR) analysis. We measured the concentration of synthesized cDNA using a spectrophotometer or a specialized instrument to ensure equal amounts of cDNA were used in subsequent qRT-PCR reactions. qRT-PCR was performed using FastStart Universal SYBR Green Master (Roche, Shanghai, China) and StepOnePlus Real-Time PCR System (Applied Biosystems, Foster, CA, USA). The primers are listed in Supplementary Table S2 . qRT-PCR reactions were performed using the SYBR® Premix Ex TaqTM kit (TaKaRa, Tokyo, Japan) with the following conditions: 95 °C for 10 min, then 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Relative gene expression levels were calculated by the 2−∆∆Ct method [41 (link)]. Three independent experiments were performed for all reactions.
4
RT-PCR Detection of Viral RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from supernatant of cell cultures or swabs samples using RNA extraction kit (Vazyme Biotech Co., Ltd., Nanjing, China) according to the manufacturer’s instruction. A 20 μL RT-PCR mix was prepared with Easyscript one-step RT-PCR supermix (Transgen, Bio, Inc., Beijing, China) and contained 10 μL of 2 × R-Mix buffer, 0.5 μM of each primer (MRV-L1F and MRV-L1R, Table 1 ), 0.5 μL of E-Mix, and 4 μL RNA. The RT-PCR was performed with the following protocol: reverse transcription at 45 °C for 40 min, initial denaturation at 95 °C for 5 min; followed by 35 cycles at 95 °C for 30 s, 50 °C for 30 s, and 72 °C for 45 s; and a following final extension at 72 °C for 7 min. Amplification products of 560 bp were detected by 1.2% agarose gel.
5
Comparative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Partial lung lobes of mice and 16HBE cells were collected, and total RNA was extracted using an RNA Extraction Kit (Vazyme, Nanjing, China). cDNA was synthesised using a reverse transcription kit and stored at –20°C. The primer sequences for each gene have been listed in Table S2
6
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA Extraction Kit (Vazyme) was used to extract pure RNA. We used reverse transcription system (Toyobo) to synthesise complementary DNA. qRT‐PCR was performed on an Applied Biosystems 7900 Fast Real‐Time PCR System using SYBR Green PCR master mix. We normalised gene expression levels against internal control and displayed relative gene expression levels using the 2−ΔΔCT method. (Table S1 )
7
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An RNA extraction kit (Vazyme, Nanjing, China) was used for total RNA extraction following the manufacturer’s instructions. The RNA concentration was measured using a MICRO Spectrophotometer-k5800 (KAIAO, Beijing, China). The integrity of the RNA was verified by 1% agarose gel electrophoresis. Based on the recommendation of the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China), 1 μg total RNA was used for cDNA synthesis. The total system volume was 20 µL.
8
Gene Expression Analysis of Muscle Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fifty milligram collected breast and leg muscles with 1 mL TRIzol reagent (Invitrogen, CA) was thoroughly ground in liquid nitrogen and transferred into a 1.5 mL Eppendorf tube for further analysis. Total RNA was extracted with an RNA extraction kit (Vazyme Cat. RC112-01, 50 rxn), and levels of relative expression of sterol regulatory element-binding protein-1 (SREBP-1) and phosphorylase kinase gamma subunit 1 (PHKG1) genes were determined with real-time PCR. Primers for SREBP-1 and PHKG1 were selected according to the geese sequences registered in NCBI and designed by using Beacon Designer 7, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The primer sequences were shown in Table 4 . The total real-time PCR system volume was 10 μL, and the reaction system was as follows: SYBR Green Mix 4.4 μL, upstream and downstream primers 0.3 μL each, and cDNA 5 μL. The real-time PCR procedure was as follows: 95°C for 10 min, one cycle, 95°C for 10 s, 60°C for 34 s, and 40 cycles. The Ct values of the target genes and the internal reference genes were measured, and the relative gene expression levels were calculated by the 2−ΔΔCt method. Each test was repeated at least three times.
9
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using an RNA extraction kit (RC112-01, Vazyme, Nanjing, China) according to the manufacturer’s protocol. A cDNA synthesis kit (Nanjing Vazyme Biotech Co, Nanjing, China) was used to perform reverse transcription with 1 μg RNA. Quantitative RT-PCR experiments were performed using SYBR Green PCR Master Mix in a total volume of 20 μL in the 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The conditions were as follows: Hold stage: 95 °C for 30 s; PCR stage step1: 95 °C for 10 s; step2: 60 °C for 30 s for 40 cycles; melt stage: 95 °C for 15 s and 60 °C for 60 s. Gene expression relative to glyceraldehyde-3-phosphate dehydrogenase was calculated using the 2-ΔΔCt method. The list of primers is shown in Table 2 .
Primers for real-time PCR.
| Genes | Primers (5′–3′) |
|---|---|
| PHF23-forward | GACAGTGCTACCTTGCTTGAG |
| PHF23-reverse | TCGGTTCTTTCGGTCCTTCTT |
| ACTN4-forward | ACATAGCCGATTCTCTGCCC |
| ACTN4-reverse | AAACCATCAACCACCAGGCA |
| GAPDH-forward | GGAGCGAGATCCCTCCAAAAT |
| GAPDH-reverse | GGCTGTTGTCATAACTTCTCATGG |
10
PBMC Isolation from Peripheral Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh peripheral blood samples were collected into EDTA-K2-containing tubes and centrifuged at 800 × g for 5 min. Then, the plasma was collected into the tubes and stored at -80 °C. The remaining blood components were diluted with an equal volume of phosphate buffered saline (PBS), and then PBMCs were collected by gradient centrifugation according to the Lympholyte®-H (CEDARLANE, Netherlands) manufacturer’s protocols. The total RNA in PBMCs from each case was extracted using an RNA Extraction Kit (Vazyme Biotech, Nanjing, China) as quickly as possible according to the protocol. The integrity and concentration of the RNA were assessed by a NanoDrop 2000 (Thermo Scientific, USA) spectrophotometer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!