The largest database of trusted experimental protocols

133 protocols using ab93876

1

Characterizing Cellular Differentiation via IF/IHC

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunofluorescence (IF) and immunohistochemistry (IHC) were performed as previously described in ref. 45 (link). Primary antibodies included anti-Nestin (Proteintech, 19483-1-AP, 1:200), anti-CUL4B (Sigma, C9995, 1:200), anti-OCN (Abcam, ab93876, 1:200) and anti-FABP4 (Abcam, ab92501, 1:200). Secondary antibodies included goat anti-rabbit or mouse horseradish peroxidase (HRP) and goat anti-rabbit or mouse Cy2 or Cy3 (Jackson ImmunoResearch, 1:200). Integral optical density (IOD) in IHC was quantified by ImageJ.
+ Open protocol
+ Expand
2

Protein Expression Analysis of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total protein was extracted from cells and tissues with SDS lysis buffer (Beyotime), with the concentration measured utilizing a bicinchoninic acid kit (20201ES76, YEASEN Biotechnology Co., Ltd., Shanghai, China). After separation using 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis, the sample was submitted to electrotransfer onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA) which were blocked using 5% blocking solution with skimmed milk powder and underwent overnight incubation at 4°C with primary rabbit antibodies against CGRP (ab189786, 1 : 1000, Abcam), RUNX2 (ab76956, 1 : 1000, Abcam), OCN (ab93876, 1 : 500, Abcam), ALP (ab229126, 1 : 1000, Abcam), CD45 (ab40763, 1 : 5000, Abcam), CD73 (ab133582, 1 : 5000, Abcam), and CD90 (ab92574, 1 : 1000, Abcam) as well as 1 h-incubation with horseradish peroxidase-labeled secondary antibody goat anti-rabbit IgG (ab150077, 1: 1000, Abcam) at ambient temperature. The immunocomplexes on the membrane were visualized utilizing enhanced chemiluminescence (ECL) reagent (ECL808-25, Biomiga, USA) at ambient temperature for 1 min, and band intensities were quantified with the help of Image Pro Plus 6.0 software (Media Cybernetics, Silver Springs, MD, USA).
+ Open protocol
+ Expand
3

Western Blot Analysis of Osteogenic Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total protein of cells was extracted using radioimmunoprecipitation assay lysis buffer (Beyotime, Nanjing, Jiangsu, China). The protein concentration was assessed using the bicinchoninic acid (BCA) protein assay kit (Beyotime). The samples were loaded for electrophoresis. Then, the protein was transferred to the polyvinylidene fluoride (PVDF) membranes using the wet method, electric transferred in a cold chamber at a voltage of 70 V at 4 °C for 2 h, and the PVDF membranes were removed and blocked with 5% skim milk-Tris buffered saline-Tween20 (TBST), and incubated at room temperature for 1 h. After blocking, the membranes were placed into the incubation box and cultured with rabbit anti-mouse primary antibodies anti-APT1 (1:1000, 25 kDa, ab91606, Abcam), anti-OCN (1:500, 11 kDa, ab93876, Abcam), anti-RUNX2 (1:1000, 57 kDa, ab236639, Abcam), anti-Osterix (1:1000, 47 kDa, ab209484, Abcam), anti-BMPR1a (1:1000, 60 kDa, ab264043, Abcam), BMP (1:1000, 44 kDa, ab214821, Abcam), p-Smad (1:1000, 52 kDa, ab92698, Abcam) at 4 °C overnight. Subsequently, the samples were eluted with TBST and incubated with secondary antibody goat anti-rabbit IgG (1:20000, ab6721, Abcam) at room temperature for 1 h. With GADPH (1:5000, 37 kDa, ab9485, Abcam) as the internal parameter, chemiluminescence method was employed for detection and gray analysis.
+ Open protocol
+ Expand
4

Immunofluorescent and Immunohistochemical Detection of Caspase-12 and Osteocalcin in Mouse Heads

Check if the same lab product or an alternative is used in the 5 most similar protocols
Frontal sections (5 μm) of mouse heads were used for immunofluorescent detection. Histological sections were de-paraffinized in xylene and rehydrated in a gradient series of ethanol, finishing in water. Sections were pre-treated in citrate buffer (98°C/10 min) for antigen retrieval and then incubated with primary Anti-Caspase-12 antibody (2202, Cell Signaling, Danvers, MA) overnight. For immunofluorescence, cells grown on glass were fixed, pre-treated with 0.1% triton and incubated with the primary antibodies for caspase-12 (see above) or osteocalcin (ab93876, Abcam). Primary antibodies were followed by incubation with secondary anti-rabbit antibody Alexa Fluor 488 (Thermo Fisher Scientific, United States) (1:200) for 40 min at RT. Nuclei were detected by ProLong Gold Antifade reagent with DAPI (Thermo Fisher Scientific, United States). For immunohistochemistry, mandibular slices were treated as described above. Incubation with primary antibodies: osteocalcin, caspase-12 and Runx2 (sc10758, Santa Cruz Biotechnology) was followed by treatment with the peroxidase-conjugated streptavidin-biotin system (Vectastain) and the chromogen substrate diaminobenzidine (DAB, K3466; Dako). Slides were counterstained with hematoxylin. Negative and positive controls for Caspase-12 primary antibody are included in Supplementary Figure 1.
+ Open protocol
+ Expand
5

Protein Expression Analysis by Western Blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total protein was isolated from tissues or cells (48 h after transfection) using radioimmunoprecipitation assay buffer. The protein was separated by the sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Afterward, proteins were transferred to a polyvinylidene fluoride (PVDF) membrane, and then blocked with 5% skim milk powder at room temperature for 1 h. Subsequently, the PVDF membrane was incubated with the corresponding diluted antibody overnight at 4°C. The following primary antibodies were used: rabbit antibodies to STC1 (1:1000, ab83065, Abcam, Cambridge, United Kingdom); p-JNK (1:1000, ab124956, Abcam); JNK (1:2000, ab208035, Abcam); bone morphogenetic protein-2 (BMP2; 1:1000, ab14933, Abcam). Osteocalcin (1:500, ab93876, Abcam). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; ab9485, 1:2500) was used as a normalization medium. The blot was incubated with horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (IgG) secondary antibody (ab97051, 1:2000, Abcam) for 1 h. Protein bands were visualized using the enhanced chemiluminescence detection kit (No. BB-3501, Amersham Pharmacia Biotech, Chicago, IL, United States) and Bio-Rad Image analysis system (Bio-Rad Laboratories, Inc., Hercules, CA, United States). Software Quantity One v4.6.2 was used for the further quantifying analysis.
+ Open protocol
+ Expand
6

Immunohistochemical Evaluation of Osteoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
To evaluate osteoblasts, immunostaining was performed using a standard protocol [17 (link)]. We incubated sections with primary antibodies to mouse Alkaline phosphatase (ALP, PA1004, Boster, Pleasanton, USA) and Osteocalcin (OCN, ab93876, Abcam, Cambridge, UK) overnight at 4°C. A biotinylated horseradish peroxidase detection system (Vectastain, PK-6200, Vector Laboratories, Burlingame, USA) was subsequently used to detect the immunoactivity, followed by incubation in 3,3'-diaminobenzidine (DAB, SK-4100, Vector Laboratories, Burlingame, USA) and counterstaining with hematoxylin. Also, tartrate-resistant acid phosphatase (TRAP) staining was performed for osteoclasts. Descriptive analysis to the immunostaining was performed by comparing the number of cells in the view field that are positive with the markers mentioned above. At least three mice per group were examined. Three equidistant sections spaced at 200 μm apart throughout the middle 1/3 coronal section of the vertebra were evaluated.
+ Open protocol
+ Expand
7

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The treated or untreated cells were collected, and the total protein was extracted by RIPA reagent (P0013B, Beyotime) with 1% protease inhibitors (P1030, Beyotime). After that, the concentration of the protein was determined by BCA kit (P0012, Beyotime). Then, cellular protein of 30 μg was separated by SDS-PAGE gel (P0012A, Beyotime). After electrophoresis for 90 min, the proteins were transferred on PVDF membranes (ISEQ00010/IPVH00010, MILLIPORE, MA, USA). Then, the membranes were blocked by 5% skimmed milk (D8340, Solarbio) for 1 h at room temperature, followed by incubation in primary antibodies (RUNX2, ab23981, 1:1,000, 60 kDa, Abcam, Cambridge, MA, USA; OCN, ab93876, 1:500, 11 kDa, Abcam; BCL2, ab182858, 1:2,000, 26 kDa, Abcam; GAPDH, ab181602, 1:10,000, 36 kDa, Abcam) at 4℃ overnight. Next day, the primary antibodies were recycled, and TBST (ST-673, Beyotime) was used to wash the membranes for 4 times (5 min for each time). Afterwards, secondary antibody (Goat Anti-Rabbit IgG H&L (HRP): ab6721, 1:10,000, Abcam) was incubated the membranes for 1 h (room temperature), followed by washing with TBST for 6 times (5 min for each time). Finally, ECL solution (WBKLS0500, MILLIPORE, Billerica, MA, USA) was dripped onto the membrane, and a specific imaging system (Bio-Rad, CA, USA) was used to visualize the band.
+ Open protocol
+ Expand
8

Histological Analysis of Decalcified Bone

Check if the same lab product or an alternative is used in the 5 most similar protocols
After micro-CT scanning, specimens were decalcified using 10% EDTA buffered with Tris-EDTA solution (pH 7.2–7.4, to 700 mL of PBS, add 100 g EDTA and adjust pH as needed to 7.2–7.4 by cautiously adding drops of 10 N NaOH) for 2 weeks. Before being embedded into a paraffin block, the plastic tube was removed. Those blocks were sectioned at a thickness of 4 μm and then stained with hematoxylin/eosin (HE) and Masson trichrome (MT). Histological images were acquired with a digital slide scanner (Paranoramic 250 Flash III, 3d-Histech, Budapest, Hungary). The acquired 3D images were measured using an image analysis program (Image Pro Plus, Media Cybernetics, Inc., Rockville, MD, USA). For immunohistochemistry, the sections were incubated overnight in the primary antibody at 4 °C. The next day, the sections were stained with Alexa Fluor® 488 goat anti-rabbit IgG (H + L) (Invitrogen, Waltham, MA, USA, A10034) for 1 h at room temperature. Primary antibodies used in staining were rabbit-polyclonal to osteocalcin (mouse-specific, 1:100, Abcam, Cambridge, UK, ab93876), rabbit-polyclonal to osteopontin (mouse/human-specific, 1:100, Abcam, Cambridge, UK, ab8448), and rabbit-polyclonal to CD31 (human/mouse/pig-specific, 1:50, Abcam, Cambridge, UK, ab28364), which were used to demonstrate new bone formation and angiogenesis.
+ Open protocol
+ Expand
9

Evaluating Inflammatory and Osteogenic Markers in BMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
In order to assess the gene expression of inflammatory cytokines and osteogenic-related factors, qRT-PCR was applied as we described before [32 (link)]. The primers are listed in Table 1.

Primers used for qRT-PCR.

Table 1
GeneForward PrimerReverse Primer
GADPHAGGTCGGTGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA
IL-1βTGGAGAGTGTGGATCCCAAGGGTGCTGATGTACCAGTTGG
TNF-αCTGAACTTCGGGGTGATCGGGGCTTGTCACTCGAATTTTGAGA
ALPCCAACTCTTTTGTGCCAGAGAGGCTACATTGGTGTTGAGCTTTT
OPNCAGGGAGGCAGTGACTCTTCAGTGTGGAAAGTGTGGCGTT
Runx 2TTCAACGATCTGAGATTTGTGGGGGATGAGGAATGCGCCCTA
To explore the osteogenic differentiation of BMSCs under inflammatory conditions, the protein expression of Col I, Runx2, OCN and OPN was determined by western blot analysis as we previously described [32 (link)]. Anti-Col I (ab21286, Abcam, UK), anti-Runx2 (ab236639, Abcam, UK), anti-OPN (ab283656, Abcam, UK) and anti-OCN (ab93876, Abcam, UK) primary antibodies were used in this study.
+ Open protocol
+ Expand
10

Osteoblast Immunohistochemical Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Samples were obtained from patients after informed consent had been obtained, under full ethical approval by the Peter MacCallum Cancer Centre Human Research Ethics Committee. De-waxed human trephine biopsy sections (3μM) were stained with osteocalcin antibody (Abcam ab93876, Cambridge, UK), counterstained and mounted for viewing. All areas of each section were monitored for visible osteoblasts.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!