Rneasy lipid tissue kit

Manufactured by Qiagen

Sourced in Germany, United States, United Kingdom, France, Australia, Switzerland, Netherlands, Japan

The RNeasy Lipid Tissue Kit is a laboratory equipment product designed for the isolation and purification of total RNA from lipid-rich tissues. It utilizes a guanidine-based lysis buffer and a silica-membrane technology to efficiently capture and purify RNA molecules from the sample.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

RNeasy Lipid Tissue Mini Protocol Kit (2 citations) RNeasy Mini Kit/RNeasy Lipid Tissue Mini Kit (2 citations) RNeasy lipid tissue RNA extraction kit (2 citations) Qiazol RNeasy Lipid Tissue mini kit (2 citations) RNeasy Lipid Tissue Midi Kit (24 citations) RNeasy lipid tissue micro kit (2 citations) RNeasy Lipid Tissue Mini Kit (1272 citations) RNeasy Lipid Tissue extraction kit (13 citations) RNeasy Lipid Tissue (8 citations) RNeasy Lipid Kit (43 citations)

275 protocols using rneasy lipid tissue kit

Umbilical Infection RNA and DNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissue samples of case 1 from the umbilical region were collected during a surgical intervention due to an umbilical infection. Hair samples of the tail were used for case 2. Samples were immediately stored in liquid nitrogen. TRIZOL reagent (Life Technologies, Heidelberg, Germany) and Qiagen RNeasy Lipid Tissue Kit (Qiagen, Hilden, Germany) were used to extract total RNA from tissue samples according to manufacturer’s protocol. Aliquots of 1 µg total RNA were reverse transcribed into cDNA using 20 pmol (T) 24 V primer and Omniscript Reverse Transcriptase (Qiagen) in 20 µL reactions. Genomic DNA was extracted using 500 µL EDTA-blood and a standard ethanol fraction [37 (link)].

Reinartz S., Weiß C., Heppelmann M., Hewicker-Trautwein M., Hellige M., Willen L., Feige K., Schneider P, & Distl O. (2023). A Missense Mutation in the Collagen Triple Helix of EDA Is Associated with X-Linked Recessive Hypohidrotic Ectodermal Dysplasia in Fleckvieh Cattle. Genes, 15(1), 8.

+ Open protocol

+ Expand

Quantitative mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total mRNA was isolated from the brain tissue surrounding the PAs and associated with the MCAs using the Qiagen RNeasy lipid tissue kit (Qiagen Sciences). RNA concentrations and integrity were evaluated using a NanoDrop spectrophotometer. Identical amounts of RNA were reverse transcribed using a qScript cDNA Synthesis Kit (Quanta Biosciences, Gaithesburg, MD). Real-time PCR was performed using a 96-well plate containing the cDNA and TaqMan primers and probes (Applied Biosystem, Foster City, CA) for doublecortin, synaptophysin, brain derived neurotrophic factor (BDNF), sEH, arginase 1, tumor necrosis factor-alpha (TNF-α), and superoxide dismutase 3 (SOD3). Fold changes in mRNA expression compared to the vehicle group were calculated using the 2^−ΔΔCT method and β-2-microglobulin was used as an endogenous control.^{28 (link)} The CT (cycle threshold) was defined as the number of cycles needed for the fluorescence signal to exceed background and begin increasing exponentially. We confirmed that the expression of β-2-microglobulin was not different between the groups by comparing raw CT values (23.13 ± 0.45 vs 22.97 ± 0.10, vehicle vs TPPU p=0.607).

Matin N., Fisher C., Lansdell T.A., Hammock B.D., Yang J., Jackson W.F, & Dorrance A.M. (2020). Soluble Epoxide Hydrolase Inhibition Improves Cognitive Function and Parenchymal Artery Dilation in a Hypertensive Model of Chronic Cerebral Hypoperfusion. Microcirculation (New York, N.Y. : 1994), 28(1), e12653.

+ Open protocol

+ Expand

Isolation and Characterization of Muscle RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from muscle tissue was isolated with Qiagen RNeasy^® Lipid Tissue Kit (Qiagen Inc., Valencia, CA) in accordance with the manufacturer's instructions. Briefly, the ISP muscles were homogenized in lysis buffer supplied with the kit. Total RNA was isolated and treated with DNase. The concentration and purity of the isolated RNA were determined by UV spectrophotometry (Beckman Coulter, Inc., Brea, CA). RNA with a 260/280 ratio of 1.5–2.0 was used for cDNA synthesis. cDNA was reverse transcribed from 2.5 μg of total RNA and PrimeScript RT kit (Takara Bio Inc., Otsu, Japan) in a final volume of 50 μL at 37°C for 15 min, followed by 85°C for 5 sec. The synthesized cDNA was dispensed and stored at −80°C until the subsequent polymerase chain reaction.

Ichinose T., Lesmana R., Yamamoto A., Kobayashi T., Shitara H., Shimoyama D., Takatsuru Y., Iwasaki T., Shimokawa N., Takagishi K, & Koibuchi N. (2014). Possible involvement of IGF‐1 signaling on compensatory growth of the infraspinatus muscle induced by the supraspinatus tendon detachment of rat shoulder. Physiological Reports, 2(1), e00197.

+ Open protocol

+ Expand

Quantitative RT-PCR Profiling of Microglia Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Brain homogenate from two pooled ipsilateral hemispheres from rats that received a similar treatment, were prepared and the total RNA was extracted using the Qiagen RNeasy Lipid Tissue Kit (Qiagen). Total RNA from purified microglia was extracted using the Qiagen RNeasy micro kit (Qiagen). RNA was reversed transcribed using the GoScript TM Reverse Transcriptase kit (Promega, The Netherlands). The Primers in Table 1 were either obtained from (Doorn et al., 2015) (link), or designed by (PrimerQuest tool, Integrated DNA Technologies, Iowa, USA). The qPCR was executed in 96-well plates (Applied Biosystems, CA, USA) using an ABI 7900HT Real-Time PCR system (Applied Biosystems, CA, USA). cDNA was quantified using the SYBR green Master mix (Life Technologies Europe BV, Merelbeke, Belgium). The housekeeping genes succinate dehydrogenase complex subunit A (SDHA) and tyrosine 3monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide (YWHAZ)
were selected as reference genes as their expressions were stable in different treatment groups. The Ct values of each sample were normalized relative to the mean of two reference genes and the gene expression was quantified using ΔCt (Kwapiszewska et al., 2012) (link) according to the following formula: ΔCt = mean Ct reference genes -Ct gene of interest .

Serhan A., Aerts J.L., Boddeke E.W.G.M, & Kooijman R. (2020). Neuroprotection by Insulin-like Growth Factor-1 in Rats with Ischemic Stroke is Associated with Microglial Changes and a Reduction in Neuroinflammation. Neuroscience, 426.

+ Open protocol

+ Expand

Quantifying Hippocampal Fmr1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total hippocampal RNA was isolated from 4-month-old rats (three WT and three Fmr1 KO) using the RNeasy Lipid Tissue Kit (Qiagen) as per the manufacturer’s instructions. Two micrograms of total RNA was used for cDNA synthesis using SuperScript III (Invitrogen) with oligo(dT) and random hexamers. PCR was performed using the GoTaq Green Master Mix (Promega). Fmr1 primers span exons 1 to 4 [Fmr1_e1F: CGA GGA AGG ACG AGA AGA TG and Fmr1_e4R: CAC CCT TTA TCA TCC TCA C; amplicon, 284 base pair (bp)]. Primers to GFP (GFP_F: ACG TAA ACG GCC ACA AGT TC and GFP_R: ATG CCG TTC TTC TGC TTG TC; amplicon, 421 bp) and 18S (18S_F: GTG GAG CGA TTT GTC TGG TT and 18S_R: CAA GCT TAT GAC CCG CAC TT; amplicon, 321 bp) and cDNA from a GFP transgenic mouse were used as positive controls.

Asiminas A., Jackson A.D., Louros S.R., Till S.M., Spano T., Dando O., Bear M.F., Chattarji S., Hardingham G.E., Osterweil E.K., Wyllie D.J., Wood E.R, & Kind P.C. (2019). Sustained correction of associative learning deficits after brief, early treatment in a rat model of Fragile X Syndrome. Science translational medicine, 11(494), eaao0498.

+ Open protocol

+ Expand

RNA Extraction and Sequencing from Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified from approximately 15 mg liver or gonad tissue using the RNeasy® Mini Kit (QIAGEN Pty. Ltd., Australia). Total RNA from whole brain was purified using the RNeasy® Lipid Tissue Kit (QIAGEN Pty. Ltd., Australia). On-column DNase treatments were included during purification. Total RNA concentration and purity were estimated using a NanoDrop 1000 spectrophotometer (Thermo Scientific). RNA integrity was confirmed using the Bioanalzyer 2100 (Agilent).
Sequencing was undertaken by a service provider (Australian Genome Research Facility, Melbourne, Australia). Library preparation was performed using Illumina TruSeq reagents and sequencing was conducted using the HiSeq2000 platform. Briefly, RNA quality was determined using a Bioanalyzer 2100 (Agilent) before isolation of polyA⁺ mRNA, fragmentation, and construction of cDNA libraries using the Illumina TruSeq kit according to the standard protocol. 100-cycle paired-end sequencing was undertaken using two lanes of an Illumina HiSeq2000 instrument, with three libraries multiplexed per lane.

Bain P.A., Papanicolaou A, & Kumar A. (2015). Identification of Putative Nuclear Receptors and Steroidogenic Enzymes in Murray-Darling Rainbowfish (Melanotaenia fluviatilis) Using RNA-Seq and De Novo Transcriptome Assembly. PLoS ONE, 10(11), e0142636.

+ Open protocol

+ Expand

Spinal Cord Injury Transcriptional Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

At different time points after SCI, mice receive an intraperitoneal injection of sodium pentobarbital (Dolethal). Blood was removed by perfusion with 60 mL of 0.9 % NaCl in distilled water. 0.6 cm of the spinal cord, centered into the injury site, were taken from each mouse and frozen in liquid nitrogen. Samples were homogenized with QIAzol lysis reagent and TissueRuptor (Qiagen). RNA was purified using a RNeasy Lipid Tissue kit (Qiagen) following the user’s guide protocol. RNA was reversly transcribed using Omniscript RT kit (Qiagen) wih random primers (Promega). Quantitative PCR (qPCR) was performed using a MyiQ Single-color Real-time PCR Detection System (BIO-RAD). Taqman primers for mouse Il18ra, Il1r8, and Gapdh genes were purchased from ThermoFisher Scientific. Gapdh was used as a housekeeping gene. Expression levels of targets mRNAs were normalized to the relative ratio of expression of the Gapdh gene and uninjured condition following the ΔΔCT method. 4 mice per group were used.

Amo-Aparicio J., Sanchez-Fernandez A., Li S., Eisenmesser E.Z., Garlanda C., Dinarello C.A, & Lopez-Vales R. (2020). Extracellular and nuclear roles of IL-37 after spinal cord injury. Brain, behavior, and immunity, 91, 194-201.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from keratinocytes and endothelial cells was extracted using the TRIzol reagent (InVitrogen), whereas total RNA from human and mouse skin biopsies by RNeasy Lipid Tissue Kit (Qiagen, Chatsworth, CA, USA). mRNA was reverse-transcribed into complementary DNA and analyzed by real-time PCR. GAPDH or β-2 microglobulin were used as housekeeping genes for human and murine mRNA, respectively. Primer pairs used in PCR reactions are listed in the table reported in Supplementary Table S1. Fluorescence intensity was analyzed by the ABI PRISM SDS 7000 PCR Instrument (Applied Biosystems, Branchburg, NJ, USA), using SYBR Green PCR reagents or Taqman PCR Master Mix. The values obtained from triplicate experiments were averaged, and data are presented as means ± SD.

Mercurio L., Morelli M., Scarponi C., Eisenmesser E.Z., Doti N., Pagnanelli G., Gubinelli E., Mazzanti C., Cavani A., Ruvo M., Dinarello C.A., Albanesi C, & Madonna S. (2018). IL-38 has an anti-inflammatory action in psoriasis and its expression correlates with disease severity and therapeutic response to anti-IL-17A treatment. Cell Death & Disease, 9(11), 1104.

+ Open protocol

+ Expand

Gene Expression Analysis from Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from cells was extracted using RNeasy® lipid tissue kit according to the protocol of the manufacturer (Qiagen, Hombrechtikon, Switzerland). RNA quantity was determined using Nanodrop 2000 Spectrophotometer. Reverse transcription of 50 ng RNA was perfomed using iScript™ Reverse Transcription Supermix according manufacture's recommendations (BioRad, Hercules, CA, USA). For quantitative RT-PCR, final cDNA concentration was adjusted to 10 ng in a 20 µl reaction volume.
Each reaction was performed in duplicates using Bio-Rad CFX96 Real-Time System and iQ™ SYBR ® Green Supermix (BioRad, Hercules, CA, USA) using specific primers. Gene was normalized to the reference gene acidic ribosomal phosphoprotein (Arbp) using the comparative C(T) method [19] .

Bhattacharya I., Domínguez A.P., Drägert K., Humar R., Haas E, & Battegay E.J. (2015). Hypoxia potentiates tumor necrosis factor-α induced expression of inducible nitric oxide synthase and cyclooxygenase-2 in white and brown adipocytes. Biochemical and biophysical research communications, 461(2).

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from the lumbar intumescence using a commercial kit (RNeasy Lipid Tissue Kit, Qiagen, Cat. code: 74804) and then quantified in a spectrophotometer (Nanophotometer, Implen). cDNA was obtained from 1 μg total RNA also using a commercial kit (Agilent Technologies, Affinity Script QPCR cDNA Synthesis Kit, Cat. code: 600559) and then amplified (1 μL sample) in a thermocycler (Stratagene Mx3005-P, Agilent Technologies) using SYBR Green reagent (Agilent Technologies, Brilliant II SYBR Green QPCR Master Mix, Cat. code: 600828) and the following primers (5 pmol): Pirb (F:GTCTGTGGCCTTCATCCTGTTCC, R:TGTTCAGCTCCACTCCATCCTCAG) [17 (link)], B2m (F:ATGGCTCGCTCGGTGACCCTG, R:CCGGTGGGTGGCGTGAGTATACTT) and Gapdh (F:TGCACCACCAACTGCTTA, R:GGATGCAGGGATGATGTTC). All procedures were performed according to the manufacturer’s instructions. Samples were analyzed in triplicate, and mRNA levels were obtained by the normalization of the target gene to the endogenous reference (Gapdh) and then relativized to the calibrator samples (non-operated) using the formula 2^-ΔΔCt.

Bombeiro A.L., Thomé R., Oliveira Nunes S.L., Monteiro Moreira B., Verinaud L, & de Oliveira A.L. (2016). MHC-I and PirB Upregulation in the Central and Peripheral Nervous System following Sciatic Nerve Injury. PLoS ONE, 11(8), e0161463.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!