Rna pcr kit

Total RNA was extracted from pollen tubes and other tissues using the SV Total RNA Isolation System (Promega), according to the manufacturer's instructions. To eliminate genomic DNA contamination, the RNA was treated with DNase I (Takara Bio) for 20 min. First‐strand cDNA was synthesized from total RNA using an RNA PCR Kit (Takara Bio). qRT‐PCRs (20 μL volume containing 1.5 μL cDNA as the template) were performed using an ABI 7500 Real‐Time PCR System (Applied Biosystems), following the manufacturer's instructions and using SYBR Premix Ex Taq (Perfect Real Time; Takara Bio). The qRT‐PCR was conducted with three biological replicates, and each sample was analysed at least in triplicate and normalized using MdACTIN (forward primer 5′‐GTCAGTACCGTGGGAGGGTA‐3′ and reverse primer 5′‐ ACCTCTCGCATGCTAAGC‐3′) as an internal control. Transcription levels were assessed using the 2–▵▵CT method (Schmittgen and Livak, 2008). The primer sequences used for qRT‐PCR analyses are listed in Additional file 13: Table S2.

Total RNA was extracted using TRIzol (Invitrogen, U.S.A.) according to the manufacturer’s instructions. Two micrograms of total RNA from each sample was reverse transcribed into cDNA using the RNA PCR Kit (Takara Biotechnology, Japan). The real-time quantitative PCR was performed on the ABI PRISM 7500 Sequence Detector (Applied Biosystems). Then, qRT-PCR was performed to quantify the expression level of miR-497 with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. miR-497 expression normalized to U6 was calculated using the comparative C_t method formula: 2^−ΔΔC_t. Primers for amplification of U6 and miR-497 are listed in Table 1.

In order to verify the transcriptome data, expression level of a randomly selected set of differentially regulated genes was measured by qRT-PCR. The total RNA was extracted from 10 fruits of each treatment by RNAiso Plus (TaKaRa, Japan) and then was pooled at equal quantity. After that, the RNA of three treatments (ABA, NDGA and CK) was reverse-transcribed to cDNA with RNA PCR kit (TaKaRa, Japan), respectively. qRT-PCR was performed with SYBR Premix Ex Taq (TaKaRa, Dalian, China) on ABI Step One RT-PCR system according to the manufacturer’s instructions. Three biological replicates were performed and the primer names and corresponding sequences were listed in S18 Table. Relative expression was normalized to the internal control gene β-actin gene with 2^-ΔΔCT method [40 (link)]. The untreated sample (CK) was set as the calibrator for relative expression level. Pearson’s correlation was performed to determine the correlation of genes expression in ABA and NDGA treatments relative to the control between qRT—PCR and sequencing.

RNA was isolated using the Trizol Plus kit (TaKaRa, Japan). First-strand cDNA synthesis was performed using Invitrogen kit. Subsequent PCR reactions were performed using an RNA-PCR kit (Takara, Japan). β-actin was used as an internal control.

Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. 2 μg of total RNA was reverse transcribed using RNA PCR Kit (Takara Biotechnology, Otsu, Japan), and the resulting cDNA was used as a PCR template. The mRNA levels were determined by real-time qPCR with an ABI PRISM 7900 Sequence Detector system (Applied Biosystem, Foster City, CA, USA) according to the manufacturer's instructions and normalized to GAPDH gene expression. The experiment was performed in triplicate. The sequences of primers for real-time qPCR are listed in Supplementary Table S3.