Bioruptor pico sonicator

Protein was extracted from cultured cells by resuspension in high salt buffer (50 mM Tris pH 7.5, 300 mM NaCl, 0.5% IgePal and 1 mM EDTA) followed by three cycles of sonication (30 s on/off) using a chilled Bioruptor Pico sonicator (diagenode). Protein levels were quantified by Bradford assay, and the samples were boiled for 7 min in LDS sample buffer (NuPAGE) and reducing agent (NuPAGE). Samples were run on a 4–12% bis‐tris gel (Life Technologies) and transferred using a Life technologies iBlot2 system. Membranes were blocked with 0.1% Tween 20 in PBS (PBT) + 5% milk and then blotted with the appropriate primary antibody at the relevant concentration for 1 h at room temperature (RT): EZH2 (Cell Signalling ‐ 5246S, 1:1,000), H3K27me3 (Upstate ‐ 07‐449, 1:5,000), Histone H3 (Abcam ‐ ab1791, 1:40,000). The membrane was then washed three times for 10 min at RT in PBT, blotted with an anti‐rabbit horseradish peroxidase secondary antibody (Vector ‐ PI‐1000, 1:5,000), washed again and then developed using ECL Western blotting substrate (Pierce).

TUBE2 (UM402; LifeSensors) agarose beads were used to capture polyubiquitin moieties from HCT116 p53+/+, HCT116 p53-/-, and U2OS cell lysates. Cells were harvested in TENT buffer (50 mM Tris-HCl pH 8.0, 2 mM EDTA pH 8.0, 150 mM NaCl, 1% Triton X-100; Sigma-Aldrich) complemented with 1xPIC (Roche), 20 μM PR-619 DUBi (Calbiochem), and 1x PhosSTOP (Roche), incubated on ice for 10 min, then sonicated 12x 30 sec ON/ 30 sec OFF in Bioruptor Pico sonicator (Diagenode). Afterwards, samples were centrifuged at 14,000 g for 10 min at 4°C. Protein concentration of the supernatants was measured with Pierce^TM BCA Protein Assay Kit (Thermo Fisher Scientific). 20 μl TUBEs beads/ IP were washed twice with TBST (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.1% Tween 20; Sigma-Aldrich) complemented with 1xPIC (Roche), 20 μM PR-619 DUBi (Calbiochem), and 1x PhosSTOP (Roche). Between each washing step, beads were centrifuged at 1,000 g for 1 min at 4°C. 1.5 mg protein was added to 20 μl TUBEs beads and exceeded with TENT + inhibitors up to 500 μl final volume, then samples were rotated for 2 h at 4°C. Beads–polyubiquitin complexes were washed three times with TBST + inhibitors, then eluted in 40 μl final volume of the mixture of TENT + inhibitors and NuPAGE^TM LDS Sample Buffer (4x) (Thermo Fisher Scientific) at 100°C for 10 min.

Viral RNA was obtained from 140 µl of the original sample, or after amplification in MDCK cells, using the QIAamp Viral RNA minikit QIAGEN). Next, 5 µl of viral RNA were used as template in a 50 µl multi-segment RT-PCR reaction (Superscript III high-fidelity RT-PCR kit) with influenza-specific universal primers complementary to the conserved 12–13 nucleotides at the end of all 8 genomic segments. Primer sequences and final concentrations in the reaction were as follows (influenza-complementary sequences are underlined): Opti1-F1 – 5’ GTTACGCGCCAGCAAAAGCAGG (0.1 μM); Opti1-F2 - 5’ GTTACGCGCCAGCGAAAGCAGG (0.1 μM); Opti1-R1 - 5’ GTTACGCGCCAGTAGAAACAAGG (0.2 μM). Amplicons were purified with 0.45x volume AMPure XP beads (Beckman Coulter) and 0.5–1 µg was sheared to an average fragment size of 150 bp on a Bioruptor Pico sonicator (Diagenode). Next, amplicon sequence libraries were prepared using the end repair, A-tailing, and adaptor ligation NEBNext DNA library prep modules for Illumina from New England Biolabs according to the manufacturer’s protocol. Following final size-selection with 1x volume AMPure XP beads, and secondary PCR (8 cycles) to introduce barcoded primers, multiplexed libraries were sequenced on the Illumina HiSeq 2500 platform in a single-end 100 nt run format.

ChIP analyses were performed as previously described with some modifications [22 (link)]. After cross-linking, nuclei were isolated, and sonicated to shear chromatin using a Bioruptor Pico sonicator (Diagenode, a Hologic company, Leige, Belgium). DNA concentrations in the chromatin supernatants were measured to ensure that an equal amount of chromatin (20 μg of soluble chromatin) was used for immunoprecipitation with 2 μg of anti-YAP antibody at 4°C overnight. Primers for the Wnt5a and Ctgf genes used for ChIP analyses are detailed in Supplementary Table S2. qRT-PCR was performed using SYBR Green PCR master mix (Applied Biosystems, USA) and the QuantStudio™ 3 Real-Time PCR System (Applied Biosystems, USA). The primer sets for qRT-PCR and ChIP-PCR are listed in Tables S1 and S2.

Quality control, DNA quantification, and gDNA library preparation and sequencing were performed as described previously (64 (link)). Briefly, DNA was gently sheared by using Covaris G-tube spin columns into ∼20,000-bp fragments and end repaired before ligating SMRTbell adapters (Pacific Biosciences). The resulting library was treated with an exonuclease cocktail to remove unligated DNA fragments, followed by two additional (AMPure XP) purification steps and Sage Science Blue Pippin size selection to deplete SMRTbells of <7,000 bp. Libraries were then sequenced by P5 enzyme chemistry on the Pacific Biosciences RS-II platform.
For Illumina sequencing, genomic DNA was sheared to an average fragment size of 200 bp by using a Bioruptor Pico sonicator (Diagenode). Amplicon sequence libraries were prepared by using the end repair, A-tailing, and adapter ligation NEBNext DNA library prep modules for Illumina from New England BioLabs, according to the manufacturer's protocol. Following final purification with AMPure XP beads and secondary PCR (8 cycles) to introduce barcoded primers, multiplexed libraries were sequenced on the Illumina HiSeq 2500 platform in a single-end 100-nt-run format.