Mz16f stereomicroscope

To assess the spheroid-formation capacity and compare the spheroid size of the cells, 500 cells in DMEM-F12 complete medium were placed as drops (20 μl each) into the lid of a Petri dish. The lid was then rapidly re-inverted onto the culture dish that was filled with 10 ml of sterile PBS to prevent evaporation of the drops. The hanging drop cultures were incubated at 37°C in a humidified atmosphere with 5% CO₂ for 1 week. Pictures of the spheroids inside the drop were taken using a Leica MZ16F stereomicroscope, and their comparative size was obtained measuring the area occupied by the spheres using the software NIH ImageJ.

Whole mount in situ hybridization (WISH) with Digoxigenin-labeled RNA probes was performed as described previously (Aulehla et al., 2008 (link)). Probes used in the screen were generated as follows; candidate genes from key metabolic pathways were identified with KEGG (Kyoto Encyclopedia of Genes and Genomes). Primers (IDT) were designed for chosen genes using BatchPrimer3 v1.0 software to amplify ∼800bp of 3’UTR, using genomic DNA. The T7 promoter sequence (CAGAGATGCATAATACGACTCACTATAGGGAGA) was added to the 5’ end of reverse primers to enable in vitro transcription of the PCR products. After WISH and color reaction, embryos were imaged on 1% agar/PBS plates with a MZ16F stereomicroscope (Leica) using a DFC420C Digital camera (Leica) and Leica Application Suite 3.8.0 Software. Basic linear contrast adjustments were applied to images. Scale bars were attributed to images using a calibration slide (Rapp OptoElectronic).

Stained and flat mounted retinas were imaged at high resolution with a Leica TCS SP5 confocal microscope equipped with the following objective lenses: ×10 HC PL APO Numerical Aperture (NA) 0.4, ×20 HCX PL S-APO NA 0.5, ×40 HCX PL APO NA 1.25, and ×63 HCX PL APO NA 1.40.
The cortex from stained brain vibratome sections was imaged with a Zeiss LSM880 confocal laser scanning microscope equipped with the following objective lenses: ×10 Plan Apo NA 0.45, ×20 Plan Apo NA 0.80, ×40 C Apo NA 1.20, and ×63 Plan Apo NA 1.40.
Low magnification, whole-retina pictures were acquired with a MZ16F stereomicroscope (Leica) coupled to a digital camera (Hamamatsu, C4742-95).
Image acquisition, analysis and processing was performed using LAS-AF 2.6 (Leica), ZEN Software 2.3 SP1 (Carl Zeiss), Volocity 6.3 (Perkin Elmer), Photoshop CS6 13.0 (Adobe), Illustrator CS6 16.0.0 (Adobe) and Fiji-IJ 2.0.0-rc-43^{70 (link)} software. All confocal images shown where immunostaining levels are compared or quantified are representative of 6–12 different images from three or more replicate experiments (animals) per group. Settings for scanner confocal detection and laser excitation were always kept identical between samples whenever comparisons between mutant mice and their respective controls were done.

The molting curves were generated using the protocol described in ref. ^{59 (link)}, except that the timing of the experiment was limited to 22 to 36 h post release from L1 arrest, covering L1 through L3 larval stages. The experiment relied on monitoring the level of GFP in GR1395 mgIs49 [mlt-10::GFP-pest; ttx-1::GFP] hermaphrodite larvae^{60 (link)}. Worms were maintained at 20 °C on OP50 E. coli under standard nematode growth conditions^{55 (link)}. Populations were synchronized by alkaline hypochlorite treatment of gravid hermaphrodites. Isolated eggs were allowed to hatch overnight in M9 buffer with rotation at 20 °C⁵⁶ . Between 50 and 60 L1 larvae from this population were transferred to either control plates or 2 nM medip#1 plates. Each of the two experiments consisted of six control and six treatment plates, for a total of 678 hermaphrodites (342 controls and 336 2 nM medip#1). The identity of the plates was not known to the experimenter. Animals were examined every hour and scored for GFP fluorescence on a Leica MZ16F stereomicroscope.

We11 (link)12 13 (link)27 (link) and others60 (link)61 (link)62 (link) have used a rodent model of Streptozotocin (STZ)-induced diabetes in research of diabetic embryopathy. Briefly, 8- to 10-week old female mice were intravenously injected daily with 75 mg kg⁻¹ STZ in the tail vein over 2 days to induce diabetes. Diabetes was defined as 12-h fasting blood glucose concentrations greater than or equal to 14 mM which usually occurred at 3–5 days after STZ injections. We did not detect any difference in embryonic development between STZ/insulin-treated and non-STZ-treated mice63 (link), suggesting a lack of residual toxic effect of STZ in our animal model. Insulin pellets (Linshin, Canada) were implanted subcutaneously in diabetic mice to restore euglycaemia (glucose concentrations: 4–6 mM) before mating13 (link)27 (link). On day 5.5 of pregnancy (E5.5), insulin pellets were removed to permit frank hyperglycaemia (≥14 mM glucose), so that the developing embryos were exposed to hyperglycaemia during neurulation (E8–10.5). Embryos were collected at E8.75 (14:00 at E8.5) for biochemical and molecular analyses. At E10.5, embryos were examined under a Leica MZ16F stereomicroscope (Bannockburn, IL, USA) to identify NTDs in a blinded fashion.

For the FGF-2 induced angiogenesis zebrafish yolk membrane (ZFYM) [61 (link)], 24 hpf embryos were exposed to 1-phenyl-2-thiourea (PTU) to prevent the pigmentation. At 48 hpf, embryos were manually dechorionated with forceps, anesthetized with tricaine (0.016%), and injected into the perivitelline space with 2 mL FGF-2 (1 mg/mL). The injection was performed in the proximity of developing subintestinal vessels (SIVs) using borosilicate needles and a Picospritzer microinjector (Eppendorf, Hamburg, Germany). After injection, embryos were incubated for 24 h more in the absence or the presence of Solo F–OH. Finally, embryos were fixed in 4% paraformaldehyde (PFA), stained for endogenous alkaline phosphatase (AP) activity, and photographed under a Leica MZ16 F stereomicroscope equipped with a DFC480 digital camera and ICM50 software (Leica, Wetzlar, Germany). Evaluation of the angiogenic response was performed by assigning negative (–, no response to FGF-2 injection), positive (+, mild response), or very positive (++, strong response) scores to the embryos.

Transected embryos were then imaged on a Leica MZ 16 F stereomicroscope with EL6000 fluorescent light source, or confocal microscope (Leica sp5) at various time points after transection. Immediately after injury (0 hpi) indicates zebrafish that have been transected and then immediately imaged. The EGFP⁺ neutrophils were visualised by excitation at 480 nm, mCherry macrophages at 587 nm, and TUNEL stained apoptotic DNA at 570 nm. A standardised area was selected for analysis that was applied to every image taken using ImageJ, depicted in Fig. 1a. This corresponds to a length of 0.5 mm from the tip of the body of the fish21 (link). The red line depicts the line of transection. For CDK9 knockout fish neutrophil recruitment experiments, the fish length was measured from scale and the neutrophils recruited per mm were calculated. Time-lapse imaging was performed of the injured tailfin. Images of the injured tailfin were taken every 5 min and the videos were analysed using ImageJ to track cells.