As described previously (Rutkevich et al., 2010 (link)), total RNA was isolated from cells using the RNeasy kit (Qiagen) and subjected to one-step reverse transcription PCR (Qiagen) using either human or mouse Xbp1 amplification primers: human, 5′-GGAGTTAAGACAGCGCTTGG-3′ and 5′-GAGATGTTCTGGAGGGGTGA-3′; mouse, 5′-GGCCTTGTGGTTGAGAACCAGGAG-3′ and 5′-GAGTCTGATATCCTTTTGGGCATTC-3′. As a positive control, cells were incubated with 10 μg/ml tunicamycin overnight.
One step reverse transcription pcr
Manufactured by Qiagen
One-step reverse transcription PCR is a laboratory technique that combines reverse transcription and polymerase chain reaction in a single step. It is used to amplify and detect RNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using one step reverse transcription pcr
1
Xbp1 Expression Quantification Protocol
2
RT-PCR for PRL-3 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA analysis, snap frozen tissues were homogenized using mortar and pestle while maintaining temperature at −80 °C using dry ice. RNA extraction was carried out following manufacturer’s recommendations (RNeasy Mini Kit, Qiagen). RNA was treated with DNaseI (Roche) to eliminate any contaminating DNA. PRL-3 mRNA level was determined by performing one-step reverse transcription-PCR (Qiagen) according to the manufacturer’s instructions and using the primers (5′-3′): forward (GATTACGCTGCTCGGATGAAC) annealing in HA and reverse (TTCCACTACCTTGCCGGGC) annealing in PRL-3 sequence; and the PCR program: 95°C × 2 min; [95°C× 30 s; 58°C× 45 s; 72°C ×45 s] × 30 cycles; 72°C × 5min.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!