Reddymix

Total RNAs were isolated using TRIzol reagent (Life Technologies) according to the manufacturer's protocol. One µg of RNA was reverse transcribed using M-MLV first-strand synthesis system according to the manufacturer's instructions (Life Technologies) in a total volume of 20 µl. One microliter of cDNA preparation was subsequently used for PCR according to standard procedures (ReddyMix, Thermo Scientific). Primers used to analyze the splicing profiles of the different transcripts are indicated in Table 1.
Table 1.

Primers used in the PCR analysis of the splicing profile of DM specific misregulated transcripts

RNA was prepared as described (Noble et al, 2008 (link)). 0.5 μg RNA was reverse transcribed using Superscript III (Invitrogen) according to the manufacturer’s instructions, and 1 μl of the product was subjected to PCR using ReddyMix™ (Thermo Scientific). Quantitative RT–PCR was performed as described (Noble et al, 2008 (link)). Primers used are described in Supplementary Methods.

100 ng aliquots of mouse genomic DNA were amplified using primers for either Bxv1 (Bxv1- F 5' GGCCTCGCTGTTCCTTG 3' and Bxv1-R 5' GAGAGAGCGTGGCAAACCTT 3') or murine GAPDH (mmGAPDH-F 5' AGTATGATGACATCAAGAAGG 3' and mmGAPDH-R 5' ATGGTATTCAAGAGAGTAGGG 3') in 2× Reddy Mix (Thermo Scientific, Manchester, UK) at 95 °C 3 min then 35 cycles 95 °C 30 s, 60 °C 30 s, 72 °C 3 min. PCR products were separated on a 2% agarose TAE gel. Primers to detect XMLV LTR (Fn8 5' CTGGATCTATTGATTTGAGTTGG 3' and Rn8 5' GCTTTATTGGGAACACGGGTA 3') and Human GAPDH (Hs GAPDH F 5' CCCCACACACATGCACTTACC 3' and Hs GAPDH R 5' CCTAGTCCCAGGGCTTTGATT 3').

RNAs were isolated using Tri Reagent (Sigma) according to the manufacturer's protocol. 1 μg of RNA was reverse transcribed using M-MLV first-strand synthesis system according to the manufacturer's instructions (Invitrogen) in a total of 20 μl. One microlitre of cDNA preparation was subsequently used in a semi-quantitative PCR analysis according to standard protocol (ReddyMix, Thermo Scientific). PCR amplification was carried out for 20–35 cycles within the linear range of amplification for each gene. PCR products were resolved on 1% agarose or 5% non-denaturing polyacrylamide (for splicing) gels, BET stained and quantified with ImageJ software. The ratios of exon inclusion/exclusion were quantified as a percentage of inclusion/exclusion relative to total intensity of isoform signals. To quantify the mRNA expression, real-time PCR was performed using a Lightcycler 480 (Roche). Reactions were performed with SYBR Green kit (Roche) according to the manufacturer's instructions. PCR cycles were a 15-min denaturation step followed by 50 cycles with a 94 °C denaturation for 15 s, 58 °C annealing for 20 s and 72 °C extension for 20 s. Mouse Rrlp0 mRNA or zebrafish elfa (elongation factor alpha) mRNA were used as standard. Data were analysed with the Lightcycler 480 analysis software. PCR primer sequences are listed in Supplementary Table S1.

For mutational status, we used tumour samples obtained from resection. KRAS exon 2 and 3 and TP53 exon 1–11 were amplified by PCR, using 20 ng of gDNA (KRAS) or cDNA (TP53), 12.5 µL Reddymix (ThermoFisher scientific), 1 µL forward primer and reverse primer 10 µM and 8.5 µL H₂O in a total volume of 25 µL. For KRAS, thermocycler program was as follows: 5 min 95 °C, 40 cycles of 30 s 95 °C, 30 s 50 °C, 1 min 30 s 72 °C, followed by 5 min 72 °C. We used the same protocol for TP53 only with an annealing temperature of 60 °C. Then, 0.1 µL of the PCR product was sequenced by Big Dye Terminator 1.1 and subsequently analysed by direct Sanger sequencing. Primers are listed in Table S4. BRAF mutation was tested via quantitative rt-PCR with a wild type and BRAF V600E specific primer (Table S4). Reaction was performed using SYBR green by Lightcycler 480. Ct value from BRAF mutant was subtracted with Ct value of BRAF wild type. Samples with differences of < 4 Ct values were considered as BRAF mutant.

Endodontic P. acnes isolates identified by partial 16S rRNA gene sequencing were typed by partial recA gene sequencing [18 (link)]. All selected P. acnes isolates were subcultured on FAA and grown for 24 h.
The P. acnes recA gene was amplified using primer PAR-1 (positions −96 to −75; 5′-AGCTCGGTGGGGTTCTCTCATC-3′) and primer PAR-2 (positions +1105 to +1083; 5′-GCTTCCTCATACCACTGGTCATC-3′), which generated a 1201-bp amplicon [18 (link)]. The reaction mix (final volume, 25 μl) comprised of 0.5 μl of PAR-1 (concentration 10 pmol/μl; Sigma), 0.5 μl of PAR-2 (concentration 10 pmol/μl; Sigma), 23 μl of Reddymix (Thermo Scientific) and 1 μl DNA extract.
The thermal cycling conditions included initial denaturation at 95 °C for 3 min, denaturation at 95 °C for 1 min, annealing at 55 °C for 30 s, and extension at 72 °C for 90 s, repeated for 35 cycles and a final extension at 72 °C for 10 min. Amplified products were run on a 0.5 % agarose gel and visualized under UV transillumination.
Sequencing was performed as described above. The P. acnes recA sequences were compared with GenBank sequences AY642055 (type IA), EU687255 (type IB), AY642061 (type II) and DQ672252 (type III). NJ trees were constructed using the Jukes-Cantor method with MEGA (version 4.1) software (www.megasoftware.net/).

PCR assays were performed to detect the presence of mecA gene (Table 1) in staphylococcal isolates that were phenotypically resistant to oxacillin. All the PCR assays were performed with 0.5 μl of each primer (10 pmol/μl), 1 μl of DNA and 1.1x PCR master mix (ReddyMix™, Thermo Fisher Scientific Inc., Surrey, UK) made up to a total reaction volume of 25 μl. Molecular grade water (Sigma-Aldrich Company Ltd., Gillingham, UK) was used as the negative control in all PCR assays. PCR products were analysed by agarose gel (1.5%) electrophoresis and the DNA fragments were visualised under UV light after ethidium bromide staining.