Cfx96 optics module

Secondary protein structure of HGGT was analyzed using coding sequences from Falcon and Azhul and the prediction function in Geneious Pro v5.4. Three-dimensional protein structure and function were analyzed using I-TASSER [57] (link), [58] (link).
Tissue for gene expression analysis was collected from etiolated shoots and mature embryos of Falcon and Azhul. Samples of each tissue type were germinated and maintained at two temperature treatments: room temperature and 4°C. RNA was extracted using an UltraClean Plant RNA Isolation Kit (Mo Bio, #13300-50). cDNA was synthesized using a SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, #18080-051) primed with oligo(dT). Quantitative PCR was performed using 1x SSoFast EvaGreen Supermix (BioRad, #172-5201) with 80 ng cDNA and 0.5 µM forward and reverse primers in a 12.5-µl reaction volume. Thermocycling was performed on a BioRad C1000 thermal cycler with a CFX96 optics module, with initial denaturation at 98°C for 2 min followed by 40 cycles of 98°C for 2 s and 55°C for 5 s, with a fluorescence reading taken at the end of each cycle. Analysis of RT-PCR data was performed using a BioRad algorithm based the method of Vandesompele et al. [59] .

Total RNA was isolated using the QIAamp viral RNA Mini kit (Qiagen, Valencia, CA, USA). The reverse transcription reaction consisted of RNase inhibitor, murine Maloney leukemia virus reverse transcriptase with 5 × buffer, oligo(dT) 15 primer, and a dNTP mixture (all from Promega, Madison, WI, USA). Quantitative real-time PCR was carried out using Thunderbird SYBR qPCR Mix (Toyobo, Osaka, Japan) and the CFX96 optics module (Bio-Rad, Hercules, CA, USA) with the following primers: HRV 5′-NCR-up, 5′-TCC TCC GGC CCC TGA ATG-3′ and HRV 5′-NCR-down, 5′-GAA ACA CGG ACA CCC AAA G-3′. To determine and discriminate between the negative-strand and positive-strand HRV1B RNA, AccuPower^® Rhinovirus A customized Real Time RT-PCR Kit (Bioneer Inc. Co. Daejeon, Korea) was used.

Individual corneas were removed from female mice and placed in separate tubes, treated with DNase to remove DNA, and RNA was isolated. Once purified, the RNA it was reverse-transcribed using a High-Capacity RNA-to-cDNA kit (Applied Biosystems). We next performed the qPCR using a CFX96 Optics module (Bio-Rad Laboratories), operated by CFX Manager Software version 3.1, using ready-made Power SYBR Green PCR Master Mix (Applied Biosysytems) according to the manufacturer’s protocol. For ICP4 mRNA, the forward primer was 5′-GCG TCG AGG TCG T-3′ and the reverse primer was 5′-CGC GGA GAC GGA G-3′. Gene expression of each cornea was quantified relative to the expression level of GAPDH (Forward primer: 5′-ACTCCACTCACGGCAAATTC-3′ and reverse primer: 5′-TCTCCATGGTGGTGAAGACA-3′). We determined that GAPDH message could be reliably detected between 22 and 25 cycles of PCR expansion. Positive expression of ICP4 required between 25 and 28 cycles of PCR expansion. Any product detected above 32 cycles was deemed unreliable and thus considered negative.

Total RNAs were extracted by RNeasy plus mini kit (Qiagen, Hilden, Germany), and the quality and concentration were determined by agarose electrophoresis. Then, RNAs were respectively reverse-transcribed with Goldscript cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA) as described by the manufacturer. Semi-quantitative RT-PCR was performed as described previously^{31 (link)} in a volume of 25 μl as follows: 94 °C for 4 min, 94 °C for 30 s, 60 °C for 30 s and 72 °C for 1 min for 33 cycles followed by 72 °C for 10 min. Real-time quantitative PCR was performed by CFX96 Optics Module (Bio-Rad, Singapore) with SYBR Green I Dye as described previously.^{32 (link)} All results were analyzed according to a previous report.^{33 (link)}β-Actin was used as the internal control gene.

Total RNA was extracted with Reagent kit (TIANDZ, China) according to the manufacturer's instructions. Quantificational real-time polymerase chain reaction for lncRNA-OBFC2A with specific primers from Sangon Biotech (Shanghai, People's Republic of China) was performed using Revert Aid First Strand Kit (Thermo Fisher Scientific, USA) and KAPA SYBR FAST Universal qPCR kit (KAPA, US) according to the manufacturer's protocol. β-actin was used as an endogenous control to normalize mRNA levels. The sequences of primers were as follows: lncRNA-OBFC2A: forward: 5′GTTGGTGTGCGGAGTGGTT3′; reverse: 5′GCAGAAAGCCGTTAGTCAGG3′; NOTCH1: forward: 5′CAATGAGTTC
CAGTGCGAGT3′; reverse: 5′GTAAGTGTTG GGTCCGTCCA3′; KLF15: forward: 5′TACACCAA AAGCAGCCACCT3′; reverse: 5′TCTTCTCGCACACA GGACAC3′; β-actin: forward: 5′TGAGACCTTCA ACACCCCAG3′; reverse: 5′GCCATCTCTTGCTC GAAGTC3’. Real-time reverse transcription-polymerize chain reaction was performed on Bio-Rad (CFX96™ optics module). Each sample was repeated three times. Data were analyzed by comparing cycle threshold values.