Nebuffer 3

Manufactured by New England Biolabs

Sourced in United States, China

NEBuffer 3.1 is a buffering solution designed for use in various molecular biology applications. It provides the appropriate ionic conditions to facilitate enzymatic reactions, such as DNA or RNA manipulations, during experimental procedures.

Automatically generated - may contain errors

Lab products found in correlation

64 protocols using nebuffer 3

DNA Nicking and Labeling for CRISPR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The DNA (300 ng) was first nicked with 5 U of Nt.BspQI (NEB) in 1× NEBuffer 3 (NEB) at 37°C for 2 h. The nicked DNA was then labeled with 5 U of DNA Taq Polymerase (NEB), 100 nM ATTO532-dUTP dAGC, and 1× NEBuffer 3.1 (NEB) at 72°C for 60 min. The sample was treated with 0.3 U of SAP (USB Products) at 37°C for 10 min and then 65°C for 5 min. The gRNA (2.5 µM) was incubated with 200 ng of Cas9 D10A (LabOmics), 1× NEBuffer 3 (NEB), and 1× BSA (NEB) at 37°C for 15 min. The green-labeled sample was then added to the reaction and incubated at 37°C for 1 h. The Cas9 D10A nicks were labeled with 2.5 U of Taq DNA Polymerase (NEB), 1× IrysPrep labeling mix red (BioNano Genomics), and 1× NEBuffer 3.1 (NEB) at 72°C for 60 min. The nicks were repaired with 20 kU of Taq DNA ligase (NEB), 1 mM NAD+ (NEB), 100 nM dNTPs, and 1× NEBuffer 3.1 (NEB) at 37°C for 30 min.

McCaffrey J., Young E., Lassahn K., Sibert J., Pastor S., Riethman H, & Xiao M. (2017). High-throughput single-molecule telomere characterization. Genome Research, 27(11), 1904-1915.

+ Open protocol

+ Expand

Endonuclease IV Stability Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pUC19 DNA isolated from plasmid cleavage and DNA cross-linking assays with E. coli. was used for the Endonuclease IV (EndoIV) stability tests. The pUC19 DNA exposed to synthetic compounds in plasmid cleavage or DNA cross-linking assays was directly diluted and used for EndoIV stability tests. To set up each reaction, 50 ng of processed DNA was mixed with 20 units of EndoIV in NEBuffer 3.1® (New England Biolabs®), pH 7.9, in a total volume of 20 μL for 16 h−20 h (unless otherwise noted) at 37 °C. The NEBuffer 3.1® (New England Biolabs®) contained 100 mM sodium chloride, 50 mM Tris-HCl, 10 mM magnesium chloride, and 100 μg/ml BSA. To set up each negative control, 50 ng of processed DNA was mixed with NEBuffer 3.1® (New England Biolabs®), pH 7.9, in a total volume of 20 μL for 16 h−20 h (otherwise otherwise noted) at 37 °C. Following completion of the experiment, the DNA was stored at −20 °C before electrophoretic analysis.

Xue M., Wernke K.M, & Herzon S.B. (2020). Depurination of colibactin-derived interstrand cross-links.. Biochemistry, 59(7), 892-900.

+ Open protocol

+ Expand

Dephosphorylation of Nemp1 Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

When calf intestine phosphatase (CIAP) (New England Biolabs: NEB) was used, Xenopus embryos overexpressing HA-tagged Xl_Nemp1 (Xl_Nemp1-HA) were lysed in lysis buffer A. Lysates were incubated with anti-HA antibody at 4 °C for 1 h, then added with protein G-agarose beads, and incubated for another 1.5 h. The beads were washed 3 times with lysis buffer A, once with NEBuffer 3 (NEB), and incubated in NEBuffer 3 containing 0.5 u/ml of CIAP for 3 h at room temperature. When λ protein phosphatase (NEB) was used, Xenopus embryos overexpressing mouse Nemp1-HA (Mm_Nemp1-HA) were lysed in lysis buffer A without EDTA. Lysates were incubated with λ protein phosphatase in NEBuffer for Protein MetalloPhosphatases (NEB) for 45 min at 30 °C. Treated samples were analyzed by western blotting with anti-HA antibody.

Shibano T., Mamada H., Hakuno F., Takahashi S.I, & Taira M. (2015). The Inner Nuclear Membrane Protein Nemp1 Is a New Type of RanGTP-Binding Protein in Eukaryotes. PLoS ONE, 10(5), e0127271.

+ Open protocol

+ Expand

Nanoparticle-Based EXPAR Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

EXPAR templates, DNA targets and DNA probe functionalized on AuNPs were purchased from Integrated DNA Technologies. The sequences of DNA used are shown in Table 2. The Vent (exo-) polymerase, Nt.BtsNBI nicking enzyme, the ThermoPol buffer, the NEBuffer 3.1, BSA, SSB proteins, dNTPs and the Streptavidin magnetic beads, were purchased from New England BioLabs. The Biotin-11-dUTP was obtained from Biotium. Ethylene glycol, propylene glycol, betaine, DMSO, trehalose, TMAC, and HAuCl₄, sodium citrate dehydrate, 4-mercaptobenzoic acid (MBA) were purchased from Sigma-Aldrich.

Mok E., Wee E., Wang Y, & Trau M. (2016). Comprehensive evaluation of molecular enhancers of the isothermal exponential amplification reaction. Scientific Reports, 6, 37837.

+ Open protocol

+ Expand

Synthesizing and Characterizing DNA Hairpins

Check if the same lab product or an alternative is used in the 5 most similar protocols

All oligonucleotides used in this study were synthesized and purified by Tsingke Biotechnology Co., Ltd. (Wuhan, China) and Sangon Biotech Co., Ltd. (Shanghai, China). Vent (exo-) DNA Polymerase (Vent), Nt.BstNBI nicking enzyme (Nt.BstNBI), 10× NEBuffer 3.1 (1 M NaCl, 500 mM Tris–HCl, 100 mM MgCl₂, 1 mg/ml BSA, pH 7.9), 10× ThermoPol Reaction Buffer (200 mM Tris–HCl, 100 mM (NH₄)₂SO₄, 100 mM KCl, 20 mM MgSO₄, 0.1% Triton X-100, pH 8.8) were purchased from New England Biolabs Inc. (Beijing, China). Deoxynucleotides (dNTPs, 2.5 mM) was purchased from Tiangen Biotech Co. Ltd. (Beijing, China). Agarose, 5× TBE Buffer, 4S Red Plus Nucleic Acid Stain, 6× DNA Loading Dye and DNA Marker A (25–500 bp) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The concentration of DNA oligonucleotides was measured using a NanoDrop 2000 UV–vis spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The sequences of all oligos are listed in Supplementary Table S1. The secondary structure of TJDHs at 55°C predicted by NUPACK (http://nupack.org/) (29–32 (link)) is shown in Supplementary Figure S5.

Xie T., Deng Y., Zhang J., Zhang Z., Hu Z, & Wu T. (2022). DNA circuits compatible encoder and demultiplexer based on a single biomolecular platform with DNA strands as outputs. Nucleic Acids Research, 50(15), 8431-8440.

+ Open protocol

+ Expand

Oligonucleotide Design and Synthesis for Nanocomposites

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All oligonucleotides were synthesized, purified, and purchased from Integrated DNA Technologies (Coralville, IA). The sequences used are enumerated in Table S1 and their designs were assisted with tools in NUPACK (www.nupack.org) and DINAMelt (http://unafold.rna.albany.edu/). All enzymes, proteins, and the NEBuffer 3.1 were procured from New England Biolabs (Ipswich, MA). Glycerol and dNTP mix were purchased from Promega Corporation (Madison, WI). SYBR™ Gold Nucleic Acid Gel Stain (10,000x concentrate in DMSO) was obtained from Thermo Fisher Scientific Inc. (Waltham, MA). CoOOH nanoflakes were synthesized and purified in-house. Single-donor serum was purchased from Innovative Research Inc. Gold nanospheres were purchased from nanoComposix (San Diego, CA). Graphene oxide sheets were obtained from the Nanotechnology Health Implications Research Consortium established by the National Institute of Environmental Health Sciences (NIEHS)[41 (link),42 ]. All dilutions were prepared using ultrapure water unless otherwise stated.

Trinh M.P., Carballo J.G., Adkins G.B., Guo K, & Zhong W. (2020). Physical and Chemical Template-Blocking Strategies in the Exponential Amplification Reaction of Circulating MicroRNAs. Analytical and bioanalytical chemistry, 412(11), 2399-2412.

+ Open protocol

+ Expand

CRISPR-Cas9 RNA Synthesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

S. pyogenes Cas9 (# M0386M), EnGen sgRNA Synthesis Kit, S. pyogenes (# E3322S), HiScribe T7 High Yield RNA Synthesis Kit (E2040S), 2× RNA Loading Dye (# B0363S), Nucleoside Digestion Mix (M0649S), Q5 Hot Start High-Fidelity 2× Master Mix (# M0494L), Monarch PCR & DNA Cleanup Kit (# T1030L), Proteinase K (# P8107S), Shrimp Alkaline Phosphatase (# M0371S), T4 Polynucleotide Kinase (# M0201S), Streptavidin Magnetic Beads (# S1420S), and NEBuffer 3.1 (# B7203S) with a 1× composition of 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl₂, 100 μg/ml BSA, pH 7.9 at 25°C were all from New England Biolabs. Both S. pyogenes and S. aureus Cas9 were purified at New England Biolabs using standard liquid chromatography protein purification techniques. Protein stock concentration for both Spy- and SauCas9 was measured by absorbance of 280 nm light on a NanoDrop instrument (A₂₈₀) as well as Bio-Rad Bradford assays per manufacturer protocol. All DNA oligomers were ordered from Integrated DNA Technologies. The Zymo RNA Clean & Concentrator-5 kit (#R1016) was purchased from Zymo Research. The SequaGel–UreaGel (# EC-833) system was from National Diagnostics. Yeast tRNA (# AM7119), 6% (# EC62652), and 15% (# EC6885) Tris-Borate EDTA gels were from Invitrogen/Thermo Fisher Scientific. γ-32P-ATP was from PerkinElmer (# BLU002A100UC).

Yourik P., Fuchs R.T., Mabuchi M., Curcuru J.L, & Robb G.B. (2019). Staphylococcus aureus Cas9 is a multiple-turnover enzyme. RNA, 25(1), 35-44.

+ Open protocol

+ Expand

CRISPR-Cas9 Cleavage of Orientia and Bunyavirus DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCR products (400 ng), which contained each Orientia Tsutsugamushi and bunyavirus DNA sequence, were mixed with 5.9 μl of rehydration buffer and 0.5 μl of 280 mM MgAc solution supplied in TwistAmp Basic RT kit. In 10 μl reactions, buffer mixed PCR products were incubated with 1 μg Cas9 protein and 750 ng sgRNA for 1 h at 37 °C as previous study [33 (link)]. For the positive control of the cleavage assay, same PCR products were cleaved in 1× NEBuffer 3.1 (100 mM NaCl, 50 mM Tris−HCl, 10 mM MgCl₂, 100 μg/ml BSA, New England BioLabs) condition. The RNase A (4 μg) was added to samples to remove sgRNA and the final samples were analyzed with agarose gel electrophoresis.

Koo B., Kim D.E., Kweon J., Jin C.E., Kim S.H., Kim Y, & Shin Y. (2018). CRISPR/dCas9-mediated biosensor for detection of tick-borne diseases. Sensors and Actuators. B, Chemical, 273, 316-321.

+ Open protocol

+ Expand

Pyrosequencing for KRAS Codon 12 Mutations

Check if the same lab product or an alternative is used in the 5 most similar protocols

MES protocols for KRAS codon 12 have previously been defined [26] (link), [27] (link). In brief, the first PCR was performed using 1× Immomix buffer with 4 µL of CTC DNA sample, and 10 µM of each primer. The primers used were: 5′– ACTGAATATAAACTTGTGGTAGTTGGACCT–3′ and 5′– TCAAAGAATGGTCCTGGACC– 3′. Touchdown PCR was used for the first round of amplification to selectively amplify the human KRAS gene. After an initial 15 min at 94°C, cycling conditions were 60 s at 94°C, 40 s at 62°C, 40 s at 72°C. For the next 10 cycles the annealing temperature was decreased by 0.5°C for each cycle until a final annealing temperature of 57.5°C was reached. Products were subjected to an additional 30 cycles (60 s at 94°C, 40 s at 57.5°C, 40 s at 72°C) of PCR. PCR products were then purified, quantified, and subjected to restriction digest by the addition of BstNI and NEBuffer 3.1(New England Biolabs) for 16 hours at 60°C. Restriction digested products were then diluted to a final concentration of 1–2 ng of DNA/µL.
The second round of PCR was done using the primers 5′–/BIOTEG/ACTGAATATAAACTTGTGGTAGTTGGACCT– 3′ and 5′– TAATATGCATATTAAAACAAGATTTACCTC– 3′, for 40 cycles (60 s at 94°C, 40 s at 54°C, 40 s at 72°C). PCR products were analyzed using pyrosequencing (Pyromark MD, Qiagen) using the internal primer 5′– CGTCAAGGCACTCTTGCC–3′.

Torphy R.J., Tignanelli C.J., Kamande J.W., Moffitt R.A., Herrera Loeza S.G., Soper S.A, & Yeh J.J. (2014). Circulating Tumor Cells as a Biomarker of Response to Treatment in Patient-Derived Xenograft Mouse Models of Pancreatic Adenocarcinoma. PLoS ONE, 9(2), e89474.

+ Open protocol

+ Expand

Cas9 RNP-Mediated DNA Cleavage

Check if the same lab product or an alternative is used in the 5 most similar protocols

The reaction was assembled using 10X NEBuffer 3.1 (New England BioLabs, cat.B7203S) (1X final concentration), 1 μM Cas9 RNP (molar concentrations were adjusted for each reaction), 100 ng DNA substrate, and nuclease-Free water. The reaction was incubated at 37°C for 60 min. The reaction was stopped by adding 1 μL Proteinase K (20 mg/mL) to the mixture at 56°C for 10 min and visualized by gel electrophoresis.

Banas K., Rivera-Torres N., Bialk P., Yoo B.C, & Kmiec E.B. (2020). Kinetics of nuclear uptake and site-specific DNA cleavage during CRISPR-directed gene editing in solid tumor cells. Molecular cancer research : MCR, 18(6), 891-902.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!