Hieff clone plus multi one step cloning kit

To generate RNAi insensitive overexpression lines, we cloned the vector by using Gibson assembly method. First we cut the pVALIUM20 and pNP vector by EcoRI/NheI enzymes, PCR the coding sequences of E2F1, Upf1, aTub67C, egg, and chm-T2A-Tip60-T2A-Gcn5, then we used the Hieff Clone Plus Multi One Step Cloning Kit (Yeasen, CAT:10912ES10) to assemble them together, finally we performed site directed mutagenesis by PCR. PCR primers for all can be found in Supplementary Data 8.

The transgenic plasmids were constructed by Hieff Clone^® Plus Multi One Step Cloning Kit (YEASEN, China). The 269-bp promoter of myl7 was amplified from zebrafish genomic DNA. The coding sequence of zebrafish map1lc3b was amplified from the cDNA of 3-dpf zebrafish larvae. EGFP or mRFP sequences were purchased from the Miaolingbio Company (China). Different fragments were ligated in the tol2mini transgenic vector (56 (link)).

The plasmids and primers used in this study are listed in Tables S1 and S2. The ectABC gene cluster from Halomonas elongata was synthesized by GeneralBio (Chuzhou, China) after codon optimization (Table S3). Primers were used to amplify the pathway fragments. The vector fragment was amplified using plasmid pBARGPE1-hygro (Miaoling, Wuhan, China) as the template, with primers vector-F/R. The purified gene fragments ectA, ectB, and ectC were assembled with the vector fragment using the Hieff Clone Plus Multi One Step Cloning Kit (YEASEN, Shanghai, China), resulting in plasmid pBARGPE-hygro-ectABC (P1), pBARGPE-hygro-ectACB (P2), pBARGPE-hygro-ectBAC (P3), pBARGPE-hygro-ectBCA (P4), pBARGPE-hygro-ectCAB (P5), and pBARGPE-hygro-ectCBA (P6). The three genes in different orders were organized into an operon expressed from the respective plasmids.
The construction of the M. purpureus ectoine-producing strain (MppECT) was performed as described by Shi et al. [21 (link)]. The pBARGPE-hygro-ectABC plasmid was incubated with 100 µL of M. purpureus ATCC 16365 WT strain protoplasts to construct the ectoine-producing strain (MppECT). The expression of the ectABC gene cluster was verified by diagnostic PCR. The transformant colonies were used as templates of diagnostic PCR.

The DNA sequence for e2-BDNF transcript (about 4.3 kb) was constructed by homologous recombination (Hieff Clone^® Plus Multi One Step Cloning Kit, YEASEN, Shanghai, China #10912ES10) from exon 2 and exon 10 at the alternative splicing site, and then the sequence of Myc tag was inserted into the 3′ terminus of coding region. pAAV-miniCMV-EGFP (PackGene, Guangzhou, China, #K104) was used as the backbone to generate the AAV plasmid of e2-BDNF-Myc. The plasmid was transfected into HEK293T cells, and 48 h later, cell lysates were harvested to detect the protein expression using an anti-Myc antibody in western blot experiment. AAV2-miniCMV-e2-BDNF-Myc was packaged by PackGene.

The 3FLAG-DRAM1-GCaMP6 expression plasmid, TMEM192-3HA, and DRAM1-BioID2-FLAG were generated by homologous recombination. 3FLAG-DRAM1, DRAM1, and TMEM192-3HA were generated by PCR subcloning of the human DRAM1 and TMEM192 coding sequences, GCaMP6 and BioID2 were generated by PCR subcloning of GCaMP6 plasmid and BioID2 plasmid, respectively. 3FLAG-DRAM1 and GCaMP6 or DRAM1 and BioID2-FLAG were homologously recombined using the Hieff Clone® Plus Multi One Step Cloning Kit (Yeason, China) according to the manufacturer’s instructions. Information on labeling organelle with plasmids is included in Supplementary Table 1.
HEK293T, A549 cells, H1975 cells, or PC9 cells were cultured at 70–80% confluence in 24-well plates on the day before transfection. Lipofectamine 2000 reagent (0.5 μl) was diluted with 25 μl Opti-MEM and gently blended with 25 μl Opti-MEM containing 0.5 μg plasmid. The mixture was placed at room temperature for 15 min and added to the cell culture medium. The medium was changed to fresh medium after 6 h, and immunofluorescence assay was conducted after another 42 h.

sgRNA target sites with the PAM sequence were synthesized and annealed then cloned into the SpeI/BamHI-digested (to remove the U6B: sgRNA elements) sgRNA2.0 luciferase reporter vector to form luciferase reporter plasmid (Jia et al. 2018 (link)). In these plasmids, firefly luciferase gene is under the control of the HSP70b promoter and the sgRNA target site is 255bp (for experiments comparing the effects of T and NT strand) or 53bp (for remaining experiments) upstream from the TSS.
CRISPRa plasmid was modified from the flySAM2.0 vector. The vermilion-attB-gypsy-UAS-DSCP fragment of flySAM2.0 vector was replaced with an Act5C promoter amplified from the pAc5.1A vector (forward primer: CGAATTGGGTACAAGCTTAAAATCATGAATGGCATCAACTCTG; reverse primer: TGGGGCCATGGTGGCGGTACCGTCTCTGGATTAGACGACTGCTG) using the Hieff Clone Plus Multi One Step Cloning Kit (Yeasen Biotech, Catlog#10912ES10). The resulting vector is named the CRISPRa plasmid. Like construction of CRISPRa lines, sgRNAs targeting luciferase reporter were cloned into the CRISPRa plasmid; see Table S2 for sgRNA sequences.