Py100

Manufactured by Cell Signaling Technology

The PY100 is a laboratory equipment product. It serves as a general-purpose platform for various analytical and research applications. The core function of the PY100 is to provide a reliable and consistent performance for the intended use.

Automatically generated - may contain errors

Lab products found in correlation

Rabbit anti myc, by Cell Signaling Technology (1 mentions) Anti fgfr4, by Santa Cruz Biotechnology (1 mentions) Anti fgfr1, by Abcam (1 mentions) Anti fgfr2, by Santa Cruz Biotechnology (1 mentions) Mouse anti flag m2, by Santa Cruz Biotechnology (1 mentions) Polymyxin b, by Merck Group (1 mentions) Pam3csk4, by Thermo Fisher Scientific (1 mentions) Gardiquimod, by Thermo Fisher Scientific (1 mentions) Mapk1 3, by Cell Signaling Technology (1 mentions) Tmt10plex mass tag labeling kit, by Thermo Fisher Scientific (1 mentions) Protein a g agarose bead, by Santa Cruz Biotechnology (1 mentions) Duolinkii kit, by Olink (1 mentions) Bak bh3, by Cell Signaling Technology (1 mentions) High select fe nta phosphopeptide enrichment kit, by Thermo Fisher Scientific (1 mentions) Odyssey fc imager, by LI COR (1 mentions) Trans blot turbo system, by Bio-Rad (1 mentions) Cleaved caspase 3 asp175, by Cell Signaling Technology (1 mentions) Fer 5d2, by Cell Signaling Technology (1 mentions) Histone h3 d1h2 xp, by Cell Signaling Technology (1 mentions) Met d1c2 xp, by Cell Signaling Technology (1 mentions)

Close spelling variants of this product

Anti-phosphotyrosine antibody (PY100) (2 citations)

10 protocols using py100

Codon-Optimized HPV-31 E2 and PV Replication Assay

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Codon optimized FLAG HPV-31 E2 (DeSmet et al., 2016 (link)) and the ori-luciferase plasmids for the PV transient replication assay (Fradet-Turcotte et al., 2010 (link)) were used as previously reported (DeSmet et al., 2016 (link)). FGFR-1, 2, and 4 constructs were provided by L. Thompson (UC Irvine). A Myc tag was added to the C terminus of FGFRs by PCR amplification using the following Primers Bam-FGFR1-F: GATCGGATCCATGTGGAGCT, FGFR1-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGCGGCGTTT, Bam-FGFR2-F: GATCGGATCCATGGTCAGCT, FGFR2-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCTGTTTTAACACTG, Bam-FGFR3-F: GATCGGATCCATGGGCGCCCCT, FGFR3-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCCGTCCGCGA, Kpn-FGFR4-F: GATCGGTACCATGCGGCTGC, FGFR4-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCTGTCTGCAC, and inserted into pcDNA3. The following antibodies were used: mouse anti-FLAG M2, phospho-Tyrosine specific PY-99 (Santa Cruz) and PY-100 (Cell Signaling), rabbit anti-MYC (Cell Signaling), anti-FGFR1 (Abcam), anti-FGFR2 (Santa Cruz), and anti-FGFR4 (Santa Cruz). BPV-1 E2 was identified with B201, a mouse monoclonal antibody with an epitope between amino acids (aa) 160–220 (Breiding et al., 1996 (link)). Mouse-anti HPV-16-E2 (TVG-261) and HPV-16 E2 sheep-antiserum (Siddiqa et al., 2015 (link)) were used to identify HPV E2 proteins.

DeSmet M., Kanginakudru S., Jose L., Xie F., Gilson T, & Androphy E.J. (2018). PAPILLOMAVIRUS E2 PROTEIN IS REGULATED BY SPECIFIC FIBROBLAST GROWTH FACTOR RECEPTORS. Virology, 521, 62-68.

+ Open protocol

+ Expand

Phosphotyrosine Protein Profiling in Liver

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phosphotyrosine protein profile of liver from control and Dicer knockout mice was analyzed by Western blot using 4G 10 antiphosphotyrosine antibody essentially as described before [14 (link)].
For immunoaffinity enrichment, the lyophilized peptides were reconstituted in 1.4 ml of immunoaffinity purification (IAP) buffer containing 50 mM MOPS pH 7.2, 10 mM sodium phosphate, 50 mM NaCl. Anti-phosphotyrosine antibody pY100 (Cat # 5636S, Cell Signaling Technology, MA) and peptide solution was incubated on a rotator at 4 °C for 30 min followed by centrifugation at 1500 × g for 1 min. It was followed by two washes with IAP buffer and twice with water. Phosphopeptides were eluted using 0.1% TFA. The eluted phosphopeptide sample was desalted using C₁₈ STAGE tips as carried out previously, vacuum dried and stored at −80 °C until LC-MS/MS analysis [15 (link)].

Sahasrabuddhe N.A., Huang T.C., Kumar P., Yang Y., Ghosh B., Leach S.D., Chaerkady R, & Pandey A. (2015). Ablation of Dicer leads to widespread perturbation of signaling pathways. Biochemical and biophysical research communications, 463(3), 389-394.

+ Open protocol

+ Expand

Quantitative PCR analysis of inflammatory markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following primers were used for quantitative PCR (Eurofins MWG Operon): Actb (5′-ctaaggccaaccgtgaaaag, 5′-accagaggcatacagggaca). Tnf (5′-tcttctcattcctgcttgtgg 5′-ggtctgggccatagaactga), Il6 (5′-gctaccaaactggatataatcagga, 5′-ccaggtagctatggtactccagaa), Il12 (5′-ccatcagcagatcattctagacaa, 5′-cgccattatgattcagagactg), and Bmx (5′-gagcagcttcgcttcacc, 5′-gatttactctccatattgtcgtcca). The following compounds were used: CC-292(23 (link)) and Compound1. The following antibodies were used: Trem2(24 (link)), pY-100 (Cell Signaling Technologies, 9411), Mapk1/3 (Cell Signaling Technologies, 4695), pMapk1/3 (Cell Signaling Technologies, 4377), PT66 (Sigma, P3300), 4G10 (Millipore, 05-321), Tec (Millipore, 05-551), Bmx (BD Biosciences, 610792), Btk (BD Biosciences, 558528), and IRDye (LI-COR, 800CW and 680RD). The following additives and TLR agonists were used: Lipopolysaccharide (List Biological Labs, 434), CpG DNA (Invitrogen, tlrl-1826), Pam3CSK4 (Invitrogen, tlrl-pms), Gardiquimod (Invitrogen, tlrl-gdgs) and Polymyxin B (Sigma, P4932).

Tampella G., Kerns H.M., Niu D., Singh S., Khim S., Bosch K.A., Garrett M.E., Moguche A., Evans E., Browning B., Jahan T.A., Nacht M., Wolf-Yadlin A., Plebani A., Hamerman J.A., Rawlings D.J, & James R.G. (2015). The Tec kinase-regulated phosphoproteome reveals a mechanism for the regulation of inhibitory signals in murine macrophages. Journal of immunology (Baltimore, Md. : 1950), 195(1), 246-256.

+ Open protocol

+ Expand

TMT Phosphopeptide Enrichment Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peptides were labeled with TMT10plex Mass Tag Labeling Kits (Thermo) according to the following scheme: DMSO_6h (126), TZB_6h (127C), 6L1G_6h (127N), ARRY_6h (128C), A + T_6h (128N), DMSO_48h (129C), TZB_48h (129N), 6L1G_48h (130C), ARRY_48h (130N), A + T_48h (131). Samples were resuspended in 100 μL of 70% (v/v) ethanol, 30% (v/v) 0.5 M triethylammonium bicarbonate at pH 8.5 and incubated with TMT reagent resuspended in 40 μL anhydrous acetonitrile at room temperature for 1 hour. Dried samples were resuspended in 400 μL IP buffer (100 mM Tris-HCl, 1% Nonidet P-40 at pH 7.4) and added to 60 μL protein G agarose beads, which were loaded with anti-phosphotyrosine antibodies (12 μg 4G10 (Millipore), 12 μg PY-100 (Cell Signaling Technologies), and 12 μg PT-66 (Sigma)) overnight at 4 °C. Beads were centrifuged for 60 s at 4,000 × g for supernatant collection, washed once with 400 μL IP buffer, and washed three times with 400 μL wash buffer (100 mM Tris-HCl at pH 7.4). Antibody-peptide complexes were eluted with 70 μL 100 mM glycine at pH 2.5 for 30 min at room temperature.

Schwill M., Tamaskovic R., Gajadhar A.S., Kast F., White F.M, & Plückthun A. (2019). Systemic analysis of tyrosine kinase signaling reveals a common adaptive response program in a HER2-positive breast cancer. Science signaling, 12(565), eaau2875.

+ Open protocol

+ Expand

Phosphotyrosine Peptide Enrichment

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lyophilized peptides were reconstituted in 1.4 ml of immuno-affinity purification (IP) buffer containing 50 mM MOPS pH 7.2, 10 mM sodium phosphate, 50 mM NaCl. Anti-phosphotyrosine antibody (pY100, Cell Signaling Technology) was mixed with peptide solution and incubated on a rotator at 4°C for 45 minutes. Post-incubation, the pY100 antibody and phosphotyrosine peptide complex were washed with IP buffer and water. The phosphotyrosine peptides were eluted using 0.1% TFA. The eluted peptide samples were desalted using C₁₈ STAGE tips, vacuum dried and kept at −80°C before LC-MS analysis.

Wu X., Zahari M.S., Ma B., Liu R., Renuse S., Sahasrabuddhe N.A., Chen L., Chaerkady R., Kim M.S., Zhong J., Jelinek C., Barbhuiya M.A., Leal-Rojas P., Yang Y., Kashyap M.K., Marimuthu A., Ling M., Fackler M.J., Merino V., Zhang Z., Zahnow C.A., Gabrielson E., Stearns V., Roa J.C., Sukumar S., Gill P.S, & Pandey A. (2015). Global phosphotyrosine survey in triple-negative breast cancer reveals activation of multiple tyrosine kinase signaling pathways. Oncotarget, 6(30), 29143-29160.

+ Open protocol

+ Expand

Immunoblot and Proximity Ligation Assays for Protein Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein A/G agarose beads (Santa Cruz) and 1μg antibody as follows: pY108 BAK antibody previously characterized (16 (link)), PTPN21 (Abgent), BAK (BH3; Cell Signaling Technologies), BMX (C-17; Santa Cruz), pY100 (Cell Signaling) were used. Resultant samples were analyzed by immunoblotting.
Immunoblot analyses were carried out as previously described (16 (link)). Antibodies used were either previously published or listed (Supplementary materials and methods).
Proximity Ligation In Situ Assays were performed using a Duolink II Kit (Olink Bioscience) with anti–BMX (C-17; Santa Cruz) and BAK (BH3; Cell Signaling Technologies) antibodies.

Fox J.L, & Storey A. (2015). BMX negatively regulates BAK function thereby increasing apoptotic resistance to chemotherapeutic drugs. Cancer research, 75(7), 1345-1355.

+ Open protocol

+ Expand

Enrichment and Quantification of Phosphopeptides

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lyophilized tryptic peptide aliquots were resuspended in 400 μL of immunoprecipitation (IP) buffer [100 mM Tris-HCl, 0.3% NP-40, pH 7.4] and supplemented with a mixture of ~1 pmol of each IS peptide standard. The light/heavy peptide mixture was incubated with 60 μL protein G agarose bead slurry (Calbiochem) conjugated to an antibody cocktail containing 12 μg 4G10 (Millipore), 12 μg PT66 (Sigma) and 6 μg of pY100 (Cell Signaling Technologies), rotating overnight at 4°C. Of note, samples 1 and 2 of the A549 enrichment analysis were only incubated for 6h at 4°C, whereas sample 3 followed the described protocol with overnight incubation. Beads were washed 1x with IP buffer, 3x with 100 mM Tri-HCl, pH 7.4, and eluted in 2 rounds of 25 μL 0.2% TFA. Phosphopeptides were further enriched using High-Select Fe-NTA Phosphopeptide Enrichment Kit (Thermo Scientific) following manufacturer’s instructions with minor adjustments. Modifications include reducing the peptide volume initially added to the Fe-NTA column (50 μL) and reducing the elution volume to 2 rounds of 20 μL elutions. Peptide elutions were dried down using vacuum centrifugation to <2 μL total volume and resuspended in 5% acetonitrile in 0.1% formic acid for a total volume of 10 μL.

Stopfer L.E., Flower C.T., Gajadhar A.S., Patel B., Gallien S., Lopez-Ferrer D, & White F.M. (2021). High-density, targeted monitoring of tyrosine phosphorylation reveals activated signaling networks in human tumors. Cancer research, 81(9), 2495-2509.

+ Open protocol

+ Expand

Immunoblotting Techniques for Protein Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cell lysates were separated by SDS-PAGE and transferred to activated PVDF membranes using the TransBlot Turbo system (BioRad). Membranes were blocked and probed with primary and secondary antibodies according to standard techniques. Images were acquired using an Odyssey FC Imager (LI-COR) and quantified using Image J. Immunoblotting was performed with primary antibodies against actin (Sigma, A5441), pMET(T1234/1235) (D26)XP (Cell Signaling, #3077), MET (D1C2)XP (Cell Signaling #8198), p44/42MAPK(ERK1/2 - T202/204) (E10) (Cell Signaling, #9106), ERK1/2/MAP-Kinase (Sigma, #M5670), pY100 (Cell Signaling, #9411), FER (5D2) (Cell Signaling, #4268), pHistone H3(S10) (D2C8)XP (Cell Signaling, #3377), Histone H3 (D1H2)XP (Cell Signaling, #4499), cleaved caspase-3 (Asp175) (Cell Signaling, #9661), PARP1 (Cell Signaling, #9542), Aurora B/AIM-1 (BD Bioscience, #611082), pFAK(T397) (D20B1) (Cell Signaling, #8556), FAK (D2R2E) (Cell Signaling, #130095), MAP4K5 (KHS [E-5]) (Santa Cruz, sc-374070). Secondary antibodies were anti-rabbit and anti-mouse (GE Healthcare).

Sumi N.J., Ctortecka C., Hu Q., Bryant A.T., Fang B., Rix L.L., Ayaz M., Kinose F., Welsh E.A., Eschrich S.A., Lawrence H.R., Koomen J.M., Haura E.B, & Rix U. (2019). Divergent polypharmacology-driven cellular activity of structurally similar multi-kinase inhibitors through cumulative effects on individual targets. Cell chemical biology, 26(9), 1240-1252.e11.

+ Open protocol

+ Expand

Phosphotyrosine Peptide Enrichment and Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peptides were labeled with iTRAQ 8plex isobaric mass tags (iTRAQ, AB Sciex) (16 (link)). Labeled, phosphotyrosine peptides were enriched by immunoprecipitation (IP) with a cocktail of three anti-phosphotyrosine antibodies followed by immobilized metal affinity chromatography (IMAC), as previously described (17 (link)). Briefly, 60 µL of protein G-agarose (EMD Millipore) beads were incubated with 12 µg pY100 (Cell Signaling Technologies, CST), 12 µg PT66 (Sigma), and 12 µg 4G10 (EMD Millipore) antibodies. Resuspended iTRAQ-labeled peptides were incubated with the antibody-conjugated protein G-agarose beads. Peptides were eluted from the antibody conjugation and further enriched using an IMAC column. The retained peptides were loaded onto a C18 pre-column, separated by reverse-phase HPLC (Agilent) over a 130 minute gradient, and injected into either an Orbitrap Elite or Q Exactive mass spectrometer (Thermo Scientific) using a custom ultra-low-flow nano-electrospray interface.

Lescarbeau R.S., Lei L., Bakken K.K., Sims P.A., Sarkaria J.N., Canoll P, & White F.M. (2016). Quantitative phosphoproteomics reveals Wee1 kinase as a therapeutic target in a model of proneural glioblastoma. Molecular cancer therapeutics, 15(6), 1332-1343.

+ Open protocol

+ Expand

Phosphotyrosine Peptide Enrichment by IAP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunoaffinity purification (IAP) of phosphotyrosine peptides was performed as described [21 (link)]. Briefly, following lyophilization, desalted lyophilized tryptic peptides were reconstituted in 1.4 mL of IAP buffer (50 mM MOPS pH 7.2, 10 mM sodium phosphate, 50 mM NaCl). The reconstituted peptide mixtures were then incubated with anti-phosphotyrosine antibody beads (pY100, Cell Signaling Technology) on a rotator at 4 °C for 30 min. After incubation, phosphotyrosine peptides and the pY100 antibody complex were washed thrice with IAP buffer and then twice with water. Residual water was removed completely. Phosphopeptides were eluted from the antibody beads by acidifying the bead mixture at room temperature with 0.1% TFA. Phosphopeptides eluents were desalted with C₁₈ STAGE tips, vacuum dried and stored at − 80 °C prior to LC–MS/MS analysis.

Wu X., Zahari M.S., Renuse S., Sahasrabuddhe N.A., Chaerkady R., Kim M.S., Fackler M.J., Stampfer M., Gabrielson E., Sukumar S, & Pandey A. (2018). Quantitative phosphoproteomic analysis reveals reciprocal activation of receptor tyrosine kinases between cancer epithelial cells and stromal fibroblasts. Clinical Proteomics, 15, 21.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!