Total RNA was extracted from cell cultures using TriFast (EuroClone, Milan, Italy), according to the manufacturer’s protocol, and mRNA levels quantified by RT-PCR amplification as reported by Calarco el al. [41 (link)]. For retro-transcription, total RNA (0.5 μg) was treated as described in EuroClone standard protocol and amplified by qPCR. Specific primers for SRY-Box Transcription Factor 9 (SOX9), Collagen Type II Alpha 1 Chain (COL2A1), Aggrecan (ACAN), Cartilage Oligomeric Matrix Protein (COMP), Interleukin-6 (IL-6), Interleukin-8 (IL-8), tumor necrosis factor (TNF)-α, Matrix Metallopeptidase 3 and 13 (MMP-3 and 13), and β-Actin (ACTB) were used and listed in Table 1 . qRT-PCR was run on a 7900 HT fast real-time PCR System (Applied Biosystem, Milan, Italy). The reactions were performed according to the manufacturer’s instructions using SYBR Green PCR Master mix (Euroclone, Italy). Data were normalized using the housekeeping gene (ACTB). All reactions were run in triplicate and the results expressed as mean ± SD. The 2−ΔΔCt method was used to determine the relative quantification.
Trifast
Manufactured by Euroclone
Sourced in Italy
TriFast is a reagent used for the isolation of total RNA from a variety of biological samples, including cells, tissues, and microorganisms. It is a single-step method that utilizes a guanidinium thiocyanate-phenol-chloroform extraction procedure to efficiently separate RNA from other cellular components.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green master mix, by Thermo Fisher Scientific (4 mentions)
Sybr green pcr master mix, by Euroclone (3 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
High capacity reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Pierce glutathione magnetic beads, by Thermo Fisher Scientific (1 mentions)
Wonder rt cdna synthesis kit, by Euroclone (1 mentions)
Random primer, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
Improm 2 reverse transcriptase, by Promega (1 mentions)
Sybr green 1 master mix, by Roche (1 mentions)
Maxwell rsc simplyrna tissue kit, by Promega (1 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Superase in rnase inhibitor, by Thermo Fisher Scientific (1 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
12 protocols using trifast
1
Quantification of Chondrocyte Gene Expression
2
Corneal Tissue RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Corneal tissues (four specimens) were stained at T4 and subjected to whole EDM stripping. Peeled-off EDM was processed according to the TRIfast technique (EuroClone SpA, Milan, Italy) to extract total RNA and denatured proteins simultaneously, as below described in detail.
3
Aptamer Selection for Human DNMT1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the SELEX strategy, GST-tagged DNMT1 was used as target for the selection. Recombinant Human DNMT1 with an N-terminal GST tag was purchased from Active Motif and Pierce Glutathione Magnetic Beads (Thermo Scientific) were used to separate aptamer-GST-tagged protein complexes.
Before each cycle of SELEX, the 2′F-Py RNA pool was dissolved in RNAse free water and subjected to denaturation/renaturation steps of 85 °C for 5 min, ice for 2 min and 37 °C for 5 min. The RNA-protein incubation was performed in Binding Buffer (BB: 5 mM Tris-HCl pH 7,5; 5 mM MgCl2; 1 mM DTT; 100 mM NaCl). At each cycle, the pool was first incubated for 30 min with Glutathione Magnetic Beads with a gentle rotation, as counter-selection step, and then the unbound RNA was recovered on a magnetic separator and used for selection. The recovered sequences were incubated with GST-tagged DNMT1 at room temperature for 30 min with a gentle rotation. Aptamer-protein complexes were purified on magnetic beads. The unbound was removed on a magnetic separator and the beads containing RNA-protein complexes were washed with BB. Bound RNAs were recovered by TriFast (Euroclone) extraction and RT-PCR and finally transcribed for the following round.
Before each cycle of SELEX, the 2′F-Py RNA pool was dissolved in RNAse free water and subjected to denaturation/renaturation steps of 85 °C for 5 min, ice for 2 min and 37 °C for 5 min. The RNA-protein incubation was performed in Binding Buffer (BB: 5 mM Tris-HCl pH 7,5; 5 mM MgCl2; 1 mM DTT; 100 mM NaCl). At each cycle, the pool was first incubated for 30 min with Glutathione Magnetic Beads with a gentle rotation, as counter-selection step, and then the unbound RNA was recovered on a magnetic separator and used for selection. The recovered sequences were incubated with GST-tagged DNMT1 at room temperature for 30 min with a gentle rotation. Aptamer-protein complexes were purified on magnetic beads. The unbound was removed on a magnetic separator and the beads containing RNA-protein complexes were washed with BB. Bound RNAs were recovered by TriFast (Euroclone) extraction and RT-PCR and finally transcribed for the following round.
4
Macrophage Polarization Profiling by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Macrophage polarization and anti-inflammatory activity was evaluated by Real-Time Quantitative PCR (RT-qPCR) according to the manufacturer’s protocols. For RT-qPCR, total RNA was extracted from cells through TriFast (EuroClone, Milan, Italy), and cDNA was synthesized using Wonder RT cDNA synthesis Kit (EuroClone). Then, gene expressions of TNF-α, IL-1β, CCL18, CD206, IL-6, IL-12, and IL-10 were evaluated by 7900 HT fast Real-Time PCR System, (Applied Biosystem, Foster City, CA, USA) with SYBR Green PCR Master mix (EuroClone). Gene expression was quantified by the 2−ΔΔCt method and normalized against 𝛽-actin used as the internal reference gene. Results were expressed as fold changes versus control. Primers used for RT-qPCR are reported in Table S1 .
5
Quantitative Analysis of IFN-Responsive Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IFN response-related genes were evaluated by using quantitative RT-PCR. Briefly, at day -1 LLC1-HER2, CT26-HER2, LLC-HER2_SKO and CT26-HER2_SKO cells were seeded in 12-well plates; at day 0 cells were transfected with 3 μg of interferon stimulatory DNA (ISD) (Invivogen, San Diego, CA, USA) in a ratio of 1:1 DNA/lipofectamine or with only lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Ten hours after transfection, cells were lysed by TriFast (Euroclone, Pero, Italy) and total RNA was extracted with phenol/chloroform. Then, 3 μg of RNA was treated with RQ1 RNase-free DNase (Promega, Madison, WI, USA) to eliminate residual DNA contaminants. After Dnase inactivation for 10 min at 65 °C, 1 μg of RNA was reverse-transcribed by using ImProm-II Reverse Transcriptase (Promega, Madison, WI, USA) in a mix containing 3 mM MgCl2, 0.5 mM dNTP and 500 ng random primer (Invitrogen, Carlsbad, CA, USA). The cDNA was then amplified in a 7500 Real-Time PCR System (Applied Biosystem, Foster City, CA, USA) using SYBR Green PCR Mastermix (Applied Biosystem, Foster City, CA, USA) as reported in previous paper [33 (link)]. All oligonucleotide primers were used to a final concentration of 0.2 µM (Table 1 ). The relative abundance of target RNAs was evaluated in relation to β-actin transcript by ΔΔCt method [33 (link)].
6
Quantitative Analysis of Cytokine mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TriFast (EuroClone, Milan, Italy) was used to completely extract the RNA from cell cultures following the manufacturer’s instructions, and qRT-PCR amplification was used to determine the levels of mRNA present [33 (link)]. Total RNA (0.5 µg) was processed and amplified by qRT-PCR for retro-transcription per the EuroClone standard methodology. Table 1 provides a list of specific primers for IL-4, IL-5, IL-6, IL-13, IL-25, IL-33, TSLP, and -Actin (ACTB). qRT-PCR was run on a 7900 HT fast real-time PCR System (Applied Biosystem, Milan, Italy). In addition, the reactions were performed following the manufacturer’s instructions by utilizing the SYBR Green PCR Master mix (Euroclone, Italy). The results were normalized to the housekeeping gene (ACTB), and the 2−ΔΔCt method was performed to quantify. The results were shown as mean ±SD after each reaction was carried out in triplicate.
7
Quantifying Gene Expression in Cell Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell cultures using TriFast (EuroClone, Milan, Italy), according to the manufacturer’s protocol, and mRNA levels were measured by RT-PCR amplification as reported by De Luca et al. [29 (link)]. Specific primers for Human Matrix Metallopeptidase 9 (MMP-9), Interleukin-6 (IL-6), Interleukin-8 (IL-8), tumor necrosis factor (TNF)-α, Sirtuin 1 (Sirt1) and β-Actin (ACTB) were used and listed in Table 1 . All reactions were run in triplicate, normalized to the housekeeping gene (ACTB), and the results were expressed as mean ± SD. The 2−ΔΔCt method was used to determine the relative quantification.
8
Quantitative PCR Analysis of Stemness and EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from spheroids and adherent cells was extracted with TRIFAST (Euroclone) according to the manufacturer’s instructions. One microgram of total RNA was used for cDNA synthesis with High-Capacity reverse transcriptase (Thermofisher). Then, qPCR was performed using SYBR Green master mix (Thermofisher), according to the manufacturer’s instructions. The list of utilized primers is depicted in Table 1 .
Genes analysed and forward/reverse primer sequences used for qPCR analyses.
| Gene symbol | Forward primer (5′->3′) | Reverse primer (5′->3′) |
|---|---|---|
| CACGTGGAATACACCTGCAA | GACAAGTTTTGGTGGCACG | |
| CAGGAGCGAGATCCCT | GGTGCTAAGCAGTTGGT | |
| GTGCAGAGAGTAACGCGG | ACACACATTGTCCTCAGCCTTC | |
| TGCCCTTAAAGGAACCAATG | CTCAATGTCAAGGGCCATCT | |
| AAGTGGACATCAACGGGTTC | TGCGGAAGTCAATGTACAGC |
9
SARS-CoV-2 RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SARS-CoV-2-infected or mock-infected Huh7 and Calu-3 were collected in TriFast (EMR507100, Euroclone), and total RNA was extracted using RNeasy Kit (Qiagen). RNA from short interfering RNA (siRNA)-transfected Calu-3 and Huh7 was purified with Maxwell RSC simplyRNA Tissue Kit (Promega). DNase I was added during RNA purification, following the manufacturers’ protocols. Purified total RNA was reverse transcribed with SuperScript VILO cDNA Synthesis Kit (ThermoFisher), and complementary DNA was analysed by qPCR using SYBR Green I Master Mix (Roche) with the primers listed in Supplementary Table 2 .
10
Quantitative RT-PCR Analysis of Lcn2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TriFast reagent (Eurogold TriFast, EuroClone, Pero, IT) following the manufacturers' instructions. RNA was dissolved in RNase-free water with RNase inhibitors (SUPERase-In RNase inhibitor, Invitrogen). The amount and purity of the extracted RNA were assessed by using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). cDNA was synthesized by reverse transcription of 1 μg of RNA by using a commercial kit and random primers (High-Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Thermo Fisher Scientific) following the manufacturers’ instructions.
Singleplex real-time RT-PCR was performed on 30 ng of cDNA by using TaqMan Gene Expression Assays for mouse Lcn2 (Mm01324470_m1) and β-actin (Mm02619580_g1), TaqMan Fast Universal PCR Master Mix, and a 7500 Fast Real-Time PCR System (Applied Biosystems). The PCR cycling parameters were set up as previously described [33 (link)]. The fractional cycle number (Ct) was determined for each gene considered and results were then normalized to β-actin expression. Relative quantification of target gene expression was achieved with a mathematical method [46 (link)].
Singleplex real-time RT-PCR was performed on 30 ng of cDNA by using TaqMan Gene Expression Assays for mouse Lcn2 (Mm01324470_m1) and β-actin (Mm02619580_g1), TaqMan Fast Universal PCR Master Mix, and a 7500 Fast Real-Time PCR System (Applied Biosystems). The PCR cycling parameters were set up as previously described [33 (link)]. The fractional cycle number (Ct) was determined for each gene considered and results were then normalized to β-actin expression. Relative quantification of target gene expression was achieved with a mathematical method [46 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!