Phd dsred

For generation of genomic Myc-nephrin, we targeted the second exon of sns using using pCFD3 (#49410; Addgene, target sequence: AGTGCCAGGTGGGACCGGCT). A homology-directed repair template was assembled by a step-wise amplification of homologies upstream and downstream of the second exon of fly nephrin (sns) using a vector from the BACPAC library that covered the sns locus. A Myc sequence was inserted directly adjacent to the target’s (mutated) PAM. DsRed cDNA under P3 promoter flanked by loxP sites was derived from pHD-DsRed (Addgene plasmid #51434) and placed into the flanking intron that preceded the downstream homology. Twelve synonymous changes were introduced between Myc and the exon boundary to avoid alignment in the interjacent section. A mixture of both plasmids was injected into flies expressing Cas9 under nos regulatory sequences (#54591; BDSC) by BestGene. CRISPR-edited lines were identified by the presence of DsRed eye fluorescence and the DsRed marker was removed by crossing to flies expressing cre recombinase (#1092; BDSC). We established the resulting Myc-nephrin flies as a homozygous stock.

The pBac[3xP3::EGFP; Tc’hsp5′-Gal4Delta-3′UTR] (Addgene plasmid # 86449) was used as a donor plasmid with piggyBac insertion repeats and the 3xP3::EGFP reporter (Schinko et al., 2010 (link)). To generate pBac[3xP3::EGFP; nosO_prom::mScarlet-nosO_3′UTR], an mScarlet cassette preceded by 2 kb of promoter sequence immediately upstream of the Plodia nanos-O start codon, was synthesized in the pUC-GW-Amp backbone by Genewiz and sub-cloned into the FseI and AscI restriction sites of pBac[3xP3::EGFP; Tc’hsp5′-Gal4Delta-3′UTR]. The pBac[3xP3::DsRed] (pHD-DsRed) and pBac[3XP3::EYFP; attP] plasmids were obtained from Addgene (#64703, and #86860) and used without modification (Gratz et al., 2014 (link), 2015 (link); Stern et al., 2017 (link)). All the 3xP3-driven fluorophore genes included an SV40 termination sequence.

Hb+ single-cell clones were generated with the following flies: hs-Flp.G5.PEST.Opt, 13XLexAop2-IVS-myr::GFP, and LexAp65-T2A-hb (see below). The embryos were collected for 7 hr in 25°C, submerged in 32°C water bath for 10 min heat shock, and then followed the protocol as described above.
LexAp65-T2A-hb was generated by in-frame fusion of (FRT.stop)::LexA.P65::T2A to the N-terminus of the hb open reading frame with CRISPR-Cas9 gene editing. The ds-DNA donor vector for homology-directed repair was composed of left homologous arm (1000 bp), LexA.P65 (Pfeiffer et al., 2008 (link)), T2A (Nern et al., 2015 (link)), and the right homologous arm (1000 bp); the fragments were amplified with PCR and then assembled in pHD-DsRed (RRID:Addgene_51434) with NEBuilder (New England BioLabs). The gRNAs were generated from the vector pCFD5 (RRID:Addgene_73914) (Port et al., 2014 (link)) containing target sequence TGCATCTTGGCGGCTCTAGA and ACTACGAGCAGCACAACGCC. The ds-DNA donor vectors and gRNA vectors were co-injected into yw;nos-Cas9 (Kondo and Ueda, 2013 (link)) flies by BestGene. The selection marker 3xP3-DsRed was then removed in transgenic flies by hs-Cre.